Relaxin 2 (RLN2) (NM_134441) Human Untagged Clone

CAT#: SC309115

RLN2 (untagged)-Human relaxin 2 (RLN2), transcript variant 1



  "NM_134441" in other vectors (4)

CN¥ 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RLN2 Rabbit polyclonal Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bA12D24.1.1; bA12D24.1.2; H2; H2-RLX; RLXH2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_134441 edited
ATGCCTCGCCTGTTTTTTTTCCACCTGCTAGGAGTCTGTTTACTACTGAACCAATTTTCC
AGAGCAGTCGCGGACTCATGGATGGAGGAAGTTATTAAATTATGCGGCCGCGAATTAGTT
CGCGCGCAGATTGCCATTTGCGGCATGAGCACCTGGAGCAAAAGGTCTCTGAGCCAGGAA
GATGCTCCTCAGACACCTAGACCAGTGGCAGAAATTGTGCCATCCTTCATCAACAAAGAT
ACAGAAACCATAAATATGATGTCAGAATTTGTTGCTAATTTGCCACAGGAGCTGAAGTTA
ACCCTGTCTGAGATGCAGCCAGCATTACCACAGCTACAACAACATGTACCTGTATTAAAA
GATTCCAGTCTTCTCTTTGAAGAATTTAAGAAACTTATTCGCAATAGACAAAGTGAAGCC
GCAGACAGCAGTCCTTCAGAATTAAAATACTTAGGCTTGGATACTCATTCTCGAAAAAAG
AGACAACTCTACAGTGCATTGGCTAATAAATGTTGCCATGTTGGTTGTACCAAAAGATCT
CTTGCTAGATTTTGCTGA
Restriction Sites Please inquire     
ACCN NM_134441
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_134441.1, NP_604390.1
RefSeq Size 788 bp
RefSeq ORF 558 bp
Locus ID 6019
UniProt ID P04090
Protein Families Secreted Protein
Gene Summary This gene encodes a member of the relaxin subfamily and insulin superfamily of peptide hormones. In humans there are three non-allelic relaxin genes. This gene encodes multiple protein isoforms, at least one of which undergoes proteolytic processing. This processing generates relaxin A and B chains that are linked by disulfide bonds to form the mature peptide hormone. This hormone plays a role in the male and female reproductive systems and was initially noted for its role in pregnancy. This protein also plays broader roles in the cardiovascular system, including in the regulation of blood pressure and control of heart rate, and data from animal models shows that this protein may have anti-fibrotic and cardioprotective effects. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (1) encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...