United States
Germany
Japan
United Kingdom
China
GAGE4 (NM_001474) Human Untagged Clone
CAT＃: SC309039
GAGE4 (untagged)-Human G antigen 4 (GAGE4)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CT4.4 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001474 edited
CCGGGATCTGTGAGGCAGTGCTGTGTGGTTCCTGCCGTCCGGACTCTTTTTCCTCTACTG AGATTCATCTGTGTGAAATATGAGTTGGCGAGGAAGATCGACCTATTATTGGCCTAGACC AAGGCGCTATGTACAGCCTCCTGAAATGATTGGGCCTATGCGGCCCGAGCAGTTCAGTGA TGAAGTGGAACCAGCAACACCTGAAGAAGGGGAACCAGCAACTCAACGTCAGGATCCTGC AGCTGCTCAGGAGGGAGAGGATGAGGGAGCATCTGCAGGTCAAGGGCCGAAGCCTGAAGC TGATAGCCAGGAACAGGGTCACCCACAGACTGGGTGTGAGTGTGAAGATGGTCCTGATGG GCAGGAGATGGACCCGCCAAATCCAGAGGAGGTGAAAACGCCTGAAGAAGGTGAAAAGCA ATCACAGTGTTAAAAGAAGGCACGTTGAAATGATGCAGGCTGCTCCTATGTTGGAAATTT GTTCATTAAAATTCTCCCAATAAAGCTTTACAGCCTTCTGCAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001474 |
| Insert Size | 500 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001474.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001474.1, NP_001465.1 |
| RefSeq Size | 528 bp |
| RefSeq ORF | 354 bp |
| Locus ID | 2576 |
| UniProt ID | Q13065 |
| Gene Summary | This gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The sequences of the family members are highly related but differ by scattered nucleotide substitutions. The antigenic peptide YYWPRPRRY, which is also encoded by several other family members, is recognized by autologous cytolytic T lymphocytes. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212898 | GAGE4 (Myc-DDK-tagged)-Human G antigen 4 (GAGE4) |
CNY 3,990.00 |
|
| RC212898L3 | Lenti-ORF clone of GAGE4 (Myc-DDK-tagged)-Human G antigen 4 (GAGE4) |
CNY 5,890.00 |
|
| RC212898L4 | Lenti-ORF clone of GAGE4 (mGFP-tagged)-Human G antigen 4 (GAGE4) |
CNY 5,890.00 |
|
| RG212898 | GAGE4 (tGFP-tagged) - Human G antigen 4 (GAGE4) |
CNY 4,370.00 |
