Tryptophanyl tRNA synthetase (WARS) (NM_213645) Human Untagged Clone
CAT#: SC308690
WARS (untagged)-Human tryptophanyl-tRNA synthetase (WARS), transcript variant 3
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GAMMA-2; HMN9; IFI53; IFP53; WARS |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_213645, the custom clone sequence may differ by one or more nucleotides
ATGTTGGTGTCATTAAAAATGAGCTACAAAGCTGCCGCGGGGGAGGATTACAAGGCTGAC TGTCCTCCAGGGAACCCAGCACCTACCAGTAATCATGGCCCAGATGCCACAGAAGCTGAA GAGGATTTTGTGGACCCATGGACAGTACAGACAAGCAGTGCAAAAGGCATAGACTACGAT AAGCTCATTGTTCGGTTTGGAAGTAGTAAAATTGACAAAGAGCTAATAAACCGAATAGAG AGAGCCACCGGCCAAAGACCACACCACTTCCTGCGCAGAGGCATCTTCTTCTCACACAGA GATATGAATCAGGTTCTTGATGCCTATGAAAATAAGAAGCCATTTTATCTGTACACGGGC CGGGGCCCCTCTTCTGAAGCAATGCATGTAGGTCACCTCATTCCATTTATTTTCACAAAG TGGCTCCAGGATGTATTTAACGTGCCCTTGGTCATCCAGATGACGGATGACGAGAAGTAT CTGTGGAAGGACCTGACCCTGGACCAGGCCTATAGCTATGCTGTGGAGAATGCCAAGGAC ATCATCGCCTGTGGCTTTGACATCAACAAGACTTTCATATTCTCTGACCTGGACTACATG GGGATGAGCTCAGGTTTCTACAAAAATGTGGTGAAGATTCAAAAGCATGTTACCTTCAAC CAAGTGAAAGGCATTTTCGGCTTCACTGACAGCGACTGCATTGGGAAGATCAGTTTTCCT GCCATCCAGGCTGCTCCCTCCTTCAGCAACTCATTCCCACAGATCTTCCGAGACAGGACG GATATCCAGTGCCTTATCCCATGTGCCATTGACCAGGATCCTTACTTTAGAATGACAAGG GACGTCGCCCCCAGGATCGGCTATCCTAAACCAGCCCTGCTGCACTCCACCTTCTTCCCA GCCCTGCAGGGCGCCCAGACCAAAATGAGTGCCAGCGACCCCAACTCCTCCATCTTCCTC ACCGACACGGCCAAGCAGATCAAAACCAAGGTCAATAAGCATGCGTTTTCTGGAGGGAGA GACACCATCGAGGAGCACAGGCAGTTTGGGGGCAACTGTGATGTGGACGTGTCTTTCATG TACCTGACCTTCTTCCTCGAGGACGACGACAAGCTCGAGCAGATCAGGAAGGATTACACC AGCGGAGCCATGCTCACCGGTGAGCTCAAGAAGGCACTCATAGAGGTTCTGCAGCCCTTG ATCGCAGAGCACCAGGCCCGGCGCAAGGAGGTCACGGATGAGATAGTGAAAGAGTTCATG ACTCCCCGGAAGCTGTCCTTCGACTTTCAGTAG |
Restriction Sites | Please inquire |
ACCN | NM_213645 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_213645.1, NP_998810.1 |
RefSeq Size | 2488 bp |
RefSeq ORF | 1293 bp |
Locus ID | 7453 |
UniProt ID | P23381 |
Protein Families | Druggable Genome |
Protein Pathways | Aminoacyl-tRNA biosynthesis, Tryptophan metabolism |
Gene Summary | Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of tryptophanyl-tRNA synthetase exist, a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. Tryptophanyl-tRNA synthetase (WARS) catalyzes the aminoacylation of tRNA(trp) with tryptophan and is induced by interferon. Tryptophanyl-tRNA synthetase belongs to the class I tRNA synthetase family. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks an alternate exon compared to variant 1. The resulting isoform (b) uses a downstream start codon but has the same C-terminus compared to isoform a. Variants 3 and 4 both encode isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218539 | WARS (Myc-DDK-tagged)-Human tryptophanyl-tRNA synthetase (WARS), transcript variant 3 |
CNY 4,750.00 |
|
RC218539L3 | Lenti-ORF clone of WARS (Myc-DDK-tagged)-Human tryptophanyl-tRNA synthetase (WARS), transcript variant 3 |
CNY 6,650.00 |
|
RC218539L4 | Lenti-ORF clone of WARS (mGFP-tagged)-Human tryptophanyl-tRNA synthetase (WARS), transcript variant 3 |
CNY 6,650.00 |
|
RG218539 | WARS (tGFP-tagged) - Human tryptophanyl-tRNA synthetase (WARS), transcript variant 3 |
CNY 5,230.00 |
其它Tryptophanyl tRNA synthetase产品