Amelotin (AMTN) (NM_212557) Human Untagged Clone
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AI3B; UNQ689 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_212557 edited
TTGAGAAACCAACTGGACCTTGAGTATTGTACATTTTGCCTCGTGGACCCAAAGGTAGCA ATTTGAAACATGAGGAGTACGATTCTACTGTTTTGTCTTCTAGGATCAACTCGGTCATTA CCACAGCTCAAACCTGCTTTGGGACTCCCTCCCACAAAACTGGCTCCGGATCAGGGAACA CTACCAAACCAACAGCAGTCAAATCAGGTCTTTCCTTCTTTAAGTCTGATACCATTAACA CAGATGCTCACACTGGGGCCAGATCTGCATCTGTTAAATCCTGCTGCAGGAATGACACCT GGTACCCAGACCCACCCATTGACCCTGGGAGGGTTGAATGTACAACAGCAACTGCACCCA CATGTGTTACCAATTTTTGTCACACAACTTGGAGCCCAGGGCACTATCCTAAGCTCAGAG GAATTGCCACAAATCTTCACGAGCCTCATCATCCATTCCTTGTTCCCGGGAGGCATCCTG CCCACCAGTCAGGCAGGGGCTAATCCAGATGTCCAGGATGGAAGCCTTCCAGCAGGAGGA GCAGGTGTAAATCCTGCCACCCAGGGAACCCCAGCAGGCCGCCTCCCAACTCCCAGTGGC ACAGATGACGACTTTGCAGTGACCACCCCTGCAGGCATCCAAAGGAGCACACATGCCATT GAGGAAGCCACCACAGAATCAGCAAATGGAATTCAGTAAGCTGTTTCAAATTTTTTCAAC TAAGCTGCCTCGAATTTGGTGATACATG |
Restriction Sites | Please inquire |
ACCN | NM_212557 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to the protein associated with NM_212557.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_212557.1, NP_997722.1 |
RefSeq Size | 1073 bp |
RefSeq ORF | 630 bp |
Locus ID | 401138 |
UniProt ID | Q6UX39 |
Gene Summary | The mineralized portions of teeth, the dentin and enamel, are formed by mesenchyme-derived odontoblasts and epithelium-derived ameloblasts, respectively. As ameloblasts differentiate, they deposit specific proteins necessary for enamel formation, including amelogenin (AMELX; MIM 300391), enamelin (ENAM; MIM 606585), and ameloblastin (AMBN; MIM 601259), in the organic enamel matrix. Amelotin is specifically expressed in maturation-stage ameloblasts (Iwasaki et al., 2005 [PubMed 16304441]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221473 | AMTN (Myc-DDK-tagged)-Human amelotin (AMTN) |
CNY 2,400.00 |
|
RC221473L3 | Lenti ORF clone of Human amelotin (AMTN), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221473L4 | Lenti ORF clone of Human amelotin (AMTN), mGFP tagged |
CNY 5,890.00 |
|
RG221473 | AMTN (tGFP-tagged) - Human amelotin (AMTN) |
CNY 4,000.00 |
其它Amelotin产品