MBNL1 (NM_207296) Human Untagged Clone

CAT#: SC308427

MBNL1 (untagged)-Human muscleblind-like (Drosophila) (MBNL1), transcript variant 6



  "NM_207296" in other vectors (4)

CNY 5,510.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-MBNL1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EXP; MBNL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308427 representing NM_207296.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGTTAGTGTCACACCAATTCGGGACACAAAATGGCTAACACTGGAAGTATGTAGAGAGTTCCAG
AGGGGGACTTGCTCACGGCCAGACACGGAATGTAAATTTGCACATCCTTCGAAAAGCTGCCAAGTTGAA
AATGGACGAGTAATCGCCTGCTTTGATTCATTGAAAGGCCGTTGCTCCAGGGAGAACTGCAAATATCTT
CATCCACCCCCACATTTAAAAACGCAGTTGGAGATAAATGGACGCAATAACTTGATTCAGCAGAAGAAC
ATGGCCATGTTGGCCCAGCAAATGCAACTAGCCAATGCCATGATGCCTGGTGCCCCATTACAACCCGTG
CCAATGTTTTCAGTTGCACCAAGCTTAGCCACCAATGCATCAGCAGCCGCCTTTAATCCCTATCTGGGA
CCTGTTTCTCCAAGCCTGGTCCCGGCAGAGATCTTGCCGACTGCACCAATGTTGGTTACAGGGAATCCG
GGTGTCCCTGTACCTGCAGCTGCTGCAGCTGCTGCACAGAAATTAATGCGAACAGACAGACTTGAGGTA
TGTCGAGAGTACCAACGTGGCAATTGCAACCGAGGAGAAAATGATTGTCGGTTTGCTCATCCTGCTGAC
AGCACAATGATTGACACCAATGACAACACAGTCACTGTGTGTATGGATTACATCAAAGGGAGATGCTCT
CGGGAAAAGTGCAAATACTTTCATCCCCCTGCACATTTGCAAGCCAAGATCAAGGCTGCCCAATACCAG
GTCAACCAGGCTGCAGCTGCACAGGCTGCAGCCACCGCAGCTGCCATGTTCCCATGGTGCACGGTGCTA
CGCCAGCCACTGTGTCCGCAGCAACAACATCTGCCACAAGTGTTCCCTTCGCTGCAACAGCCACAGCCA
ACCAGCCCCATCCTTGATGCTTCTACACTGTTGGGTGCAACATCCTGTCCTGCAGCAGCAGGAAAAATG
ATACCCATAATATCTGCCGAACATCTGACTAGCCACAAGTATGTTACCCAGATGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_207296
Insert Size 1023 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_207296.1
RefSeq Size 5246 bp
RefSeq ORF 1023 bp
Locus ID 4154
UniProt ID Q9NR56
MW 37 kDa
Gene Summary This gene encodes a member of the muscleblind protein family which was initially described in Drosophila melanogaster. The encoded protein is a C3H-type zinc finger protein that modulates alternative splicing of pre-mRNAs. Muscleblind proteins bind specifically to expanded dsCUG RNA but not to normal size CUG repeats and may thereby play a role in the pathophysiology of myotonic dystrophy. Mice lacking this gene exhibited muscle abnormalities and cataracts. Several alternatively spliced transcript variants have been described but the full-length natures of only some have been determined. The different isoforms are thought to have different binding specificities and/or splicing activities. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (6) lacks two alternate exons and contains an alternate exon in the 3' coding region, compared to variant 1. These differences result in a disruption of the reading frame in a portion of the 3' coding region, compared to variant 1. The encoded isoform (f) is shorter than isoform a. Another name for this isoform is MBNL1subscript40S. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...