GCIP interacting protein p29 (SYF2) (NM_207170) Human Untagged Clone
CAT#: SC308402
SYF2 (untagged)-Human SYF2 homolog, RNA splicing factor (S. cerevisiae) (SYF2), transcript variant 2
CN¥ 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CBPIN; fSAP29; NTC31; P29 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC308402 representing NM_207170.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCTATAGCTGCATCCGAGGTGCTGGTGGACAGCGCGGAGGAGGGGTCCCTCGCTGCGGCGGCG GAGCTGGCCGCTCAGAAGCGCGAACAGAGACTGCGCAAATTCCGGGAGCTGCACCTGATGCGGGAATGT GCGGCAAGAGGAGAAGACTATGAGAAAGTGAAGTTGCTGGAGATCAGTGCAGAAGATGCAGAAAGATGG GAGAGGAAAAAGAAGAGGAAAAACCCTGATCTGGGATTTTCAGATTATGCTGCTGCCCAGTTACGCCAG TATCATCGGTTGACCAAGCAGATCAAACCTGACATGGAAACATATGAGAGACTGAGAGAAAAACATGGA GAAGAGTTTTTCCCAACATCCAATAGTCTTCTTCATGGAACACATGTGCCTTCCACAGAGGAAATTGAC AGGATGGTCATAGATCTGGAAAAACAGATTGAAAAACGAGACAAATATAGCCGGAGACGTCCTTATAAT GATGATGCAGATATCGACTACATTAATGAAAGGAATGCCAAATTCAACAAGAAAGCTGAAAGATTCTAT GGGAAATACACAGCTGAAATTAAACAGAATTTGGAAAGAGGAACAGCTGTCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_207170 |
Insert Size | 606 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_207170.3 |
RefSeq Size | 1651 bp |
RefSeq ORF | 606 bp |
Locus ID | 25949 |
UniProt ID | O95926 |
Protein Pathways | Spliceosome |
MW | 23.6 kDa |
Gene Summary | This gene encodes a nuclear protein that interacts with cyclin D-type binding-protein 1, which is thought to be a cell cycle regulator at the G1/S transition. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate exon, compared to variant 1, but maintains the reading frame. The resulting protein (isoform 2) is shorter than isoform 1 and lacks both bipartite nuclear localization signals found in isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218401 | SYF2 (Myc-DDK-tagged)-Human SYF2 homolog, RNA splicing factor (S. cerevisiae) (SYF2), transcript variant 2 |
CN¥ 2,400.00 |
|
RC218401L3 | Lenti ORF clone of Human SYF2 homolog, RNA splicing factor (S. cerevisiae) (SYF2), transcript variant 2, Myc-DDK-tagged |
CN¥ 5,890.00 |
|
RC218401L4 | Lenti ORF clone of Human SYF2 homolog, RNA splicing factor (S. cerevisiae) (SYF2), transcript variant 2, mGFP tagged |
CN¥ 5,890.00 |
|
RG218401 | SYF2 (tGFP-tagged) - Human SYF2 homolog, RNA splicing factor (S. cerevisiae) (SYF2), transcript variant 2 |
CN¥ 4,370.00 |
其它GCIP interacting protein p29产品