NADE (BEX3) (NM_206915) Human Untagged Clone
CAT#: SC308318
NGFRAP1 (untagged)-Human nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), transcript variant 2
CN¥ 3,990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Bex; DXS6984E; HGR74; NADE; NGFRAP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC308318 representing NM_206915.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAAATATTCACCAGGAAAACGAAGAGATGGAGCAGCCTATGCAGAATGGAGAGGAAGACCGCCCT TTGGGAGGAGGTGAAGGCCACCAGCCTGCAGGAAATCGACGGGGACAGGCTCGCCGACTTGCCCCTAAT TTTCGATGGGCCATACCCAATAGGCAGATCAATGATGGGATGGGTGGAGATGGAGATGATATGGAAATA TTCATGGAGGAGATGAGAGAAATCAGAAGAAAACTTAGGGAGCTGCAGTTGAGGAATTGTCTGCGTATC CTTATGGGGGAGCTCTCTAATCACCATGACCATCATGATGAATTTTGCCTTATGCCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_206915 |
Insert Size | 336 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_206915.2 |
RefSeq Size | 1072 bp |
RefSeq ORF | 336 bp |
Locus ID | 27018 |
UniProt ID | Q00994 |
Protein Families | Druggable Genome |
Protein Pathways | Neurotrophin signaling pathway |
MW | 13 kDa |
Gene Summary | May be a signaling adapter molecule involved in p75NTR-mediated apoptosis induced by NGF. Plays a role in zinc-triggered neuronal death (By similarity). May play an important role in the pathogenesis of neurogenetic diseases.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (b) has a longer N-terminus than isoform a. Variants 2 and 3 encode the same isoform (b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217196 | NGFRAP1 (Myc-DDK-tagged)-Human nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), transcript variant 2 |
CN¥ 1,200.00 |
|
RC217196L3 | Lenti ORF clone of Human nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), transcript variant 2, Myc-DDK-tagged |
CN¥ 5,890.00 |
|
RC217196L4 | Lenti ORF clone of Human nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), transcript variant 2, mGFP tagged |
CN¥ 5,890.00 |
|
RG217196 | NGFRAP1 (tGFP-tagged) - Human nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), transcript variant 2 |
CN¥ 4,370.00 |