United States
Germany
Japan
United Kingdom
China
QK1 (QKI) (NM_206853) Human Untagged Clone
CAT＃: SC308285
QKI (untagged)-Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 2
CNY 6,270.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | Hqk; hqkI; QK; QK1; QK3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC308285 representing NM_206853.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTCGGGGAAATGGAAACGAAGGAGAAGCCGAAGCCCACCCCAGATTACCTGATGCAGCTGATGAAC GACAAGAAGCTCATGAGCAGCCTGCCCAACTTCTGCGGGATCTTCAACCACCTCGAGCGGCTGCTGGAC GAAGAAATTAGCAGAGTACGGAAAGACATGTACAATGACACATTAAATGGCAGTACAGAGAAAAGGAGT GCAGAATTGCCTGATGCTGTGGGACCTATTGTTCAGTTACAAGAGAAACTTTATGTGCCTGTAAAAGAA TACCCAGATTTTAATTTTGTTGGGAGAATCCTTGGACCTAGAGGACTTACAGCCAAACAACTTGAAGCA GAAACCGGATGTAAAATCATGGTCCGAGGCAAAGGCTCAATGAGGGATAAAAAAAAGGAGGAGCAAAAT AGAGGCAAGCCCAATTGGGAGCATCTAAATGAAGATTTACATGTACTAATCACTGTGGAAGATGCTCAG AACAGAGCAGAAATCAAATTGAAGAGAGCAGTTGAAGAAGTGAAGAAATTATTGGTACCTGCAGCAGAA GGAGAAGACAGCCTGAAGAAGATGCAGCTGATGGAGCTTGCGATTCTGAATGGCACCTACAGAGATGCC AACATTAAATCACCAGCCCTTGCCTTTTCTCTTGCAGCAACAGCCCAGGCTGCTCCAAGGATCATTACT GGGCCTGCGCCGGTTCTCCCACCAGCTGCCCTGCGTACTCCTACGCCAGCTGGCCCTACCATAATGCCT TTGATCAGACAAATACAGACCGCTGTCATGCCAAACGGAACTCCTCACCCAACTGCTGCAATAGTTCCT CCAGGGCCCGAAGCTGGTTTAATCTATACACCCTATGAGTACCCCTACACATTGGCACCAGCTACATCA ATCCTTGAGTATCCTATTGAACCTAGTGGTGTATTAGGTATGGCTTTCCCAACGAAAGGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_206853 |
| Insert Size | 960 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_206853.2 |
| RefSeq Size | 14152 bp |
| RefSeq ORF | 960 bp |
| Locus ID | 9444 |
| UniProt ID | Q96PU8 |
| MW | 35.1 kDa |
| Gene Summary | The protein encoded by this gene is an RNA-binding protein that regulates pre-mRNA splicing, export of mRNAs from the nucleus, protein translation, and mRNA stability. The encoded protein is involved in myelinization and oligodendrocyte differentiation and may play a role in schizophrenia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (2) differs in the 3' UTR and coding region compared to variant 1, which results in a frameshift. The resulting isoform (2; also known as HQK-6 and QKI-6) is shorter and has a distinct C-terminus compared to isoform 1. Isoforms 2 and 4 are the same length but have different C-termini. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224090 | QKI (Myc-DDK-tagged)-Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 2 |
CNY 2,400.00 |
|
| RC224090L1 | Lenti ORF clone of Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC224090L2 | Lenti ORF clone of Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC224090L3 | Lenti ORF clone of Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC224090L4 | Lenti ORF clone of Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG224090 | QKI (tGFP-tagged) - Human quaking homolog, KH domain RNA binding (mouse) (QKI), transcript variant 2 |
CNY 4,000.00 |
