Cyclophilin E (PPIE) (NM_203456) Human Untagged Clone

CAT#: SC308190

PPIE (untagged)-Human peptidylprolyl isomerase E (cyclophilin E) (PPIE), transcript variant 2



  "NM_203456" in other vectors (4)

CN¥ 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PPIE Antibody
    • 100 ul

CN¥ 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CYP-33; CYP33
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308190 representing NM_203456.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCACCACCAAGCGCGTCTTGTACGTGGGTGGACTGGCAGAGGAAGTGGACGACAAAGTTCTTCAT
GCTGCGTTCATTCCTTTTGGAGACATCACAGATATTCAGATTCCTCTGGATTATGAAACAGAAAAGCAC
CGAGGATTTGCTTTTGTTGAATTTGAGTTGGCAGAGGATGCTGCAGCAGCTATCGACAACATGAATGAA
TCTGAGCTTTTTGGACGTACAATTCGTGTCAATTTGGCCAAACCAATGAGAATTAAGGAAGGCTCTTCC
AGGCCAGTTTGGTCAGATGATGACTGGTTGAAGAAGTTTTCTGGGAAGACGCTTGAAGAGAATAAAGAG
GAAGAAGGGTCAGAGCCTCCCAAAGCAGAGACCCAGGAGGGAGAGCCCATTGCTAAAAAGGCCCGCTCA
AATCCTCAGGTGTACATGGACATCAAGATTGGGAACAAGCCGGCTGGCCGCATCCAGATGCTCCTGCGT
TCTGATGTCGTGCCCATGACAGCAGAGAATTTCCGCTGCCTGTGCACTCATGAAAAGGGCTTTGGCTTT
AAGGGAAGCAGCTTCCACCGCATCATCCCCCAGTTCATGTGCCAGGGCGGTGATTTCACAAACCACAAT
GGCACTGGGGGCAAGTCCATCTATGGGAAGAAGTTCGATGATGAAAACTTTATCCTCAAGCATACGGGA
CCAGGTCTACTATCCATGGCCAACTCTGGCCCAAACACCAATGGCTCTCAGTTCTTCCTGACATGTGAC
AAGACAGACTGGCTGGATGGCAAGCATGTGGTGTTTGGAGAGGTCACCGAAGGCCTAGATGTCTTGCGG
CAAATTGAGAAACAAGAAGAGTCAGCAATTACCAGCCAGCCGAGGTCCTGGAAGCTGACGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_203456
Insert Size 891 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_203456.2
RefSeq Size 1136 bp
RefSeq ORF 891 bp
Locus ID 10450
UniProt ID Q9UNP9
Protein Families Transcription Factors
Protein Pathways Spliceosome
MW 33.1 kDa
Gene Summary The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein contains a highly conserved cyclophilin (CYP) domain as well as an RNA-binding domain. It was shown to possess PPIase and protein folding activities, and it also exhibits RNA-binding activity. Alternative splicing results in multiple transcript variants. A related pseudogene, which is also located on chromosome 1, has been identified. [provided by RefSeq, Aug 2010]
Transcript Variant: This variant (2) uses an alternate 3' exon and thereby differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...