Stathmin 1 (STMN1) (NM_203401) Human Untagged Clone

CAT#: SC308156

STMN1 (untagged)-Human stathmin 1 (STMN1), transcript variant 1



  "NM_203401" in other vectors (7)

CNY 1,320.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


STMN1 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C1orf215; Lag; LAP18; OP18; PP17; PP19; PR22; SMN
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_203401 edited
GGGGGGTGCCTCTGTTTGGCGCTTTTGTGCGCGCCCGGGTCTGTTGGTGCTCAGAGTGTG
GTCAGGCGGCTCGGACTGAGCAGGACTTTCCTTATCCCAGTTGATTGTGCAGAATACACT
GCCTGTCGCTTGTCTTCTATTCACCATGGCTTCTTCTGATATCCAGGTGAAAGAACTGGA
GAAGCGTGCCTCAGGCCAGGCTTTTGAGCTGATTCTCAGCCCTCGGTCAAAAGAATCTGT
TCCAGAATTCCCCCTTTCCCCTCCAAAGAAGAAGGATTTTTCCCTGGAGGAAATTCAGAA
GAAATTAGAAGCTGCAGAAGAAAGACGCAAGTCCCATGAAGCTGAGGTCTTGAAGCAGCT
GGCTGAGAAACGAGAGCACGAGAAAGAAGTGCTTCAGAAGGCAATAGAAGAGAACAACAA
CTTCAGTAAAATGGCAGAAGAGAAACTGACCCACAAAATGGAAGCTAATAAAGAGAACCG
AGAGGCACAAATGGCTGCCAAACTGGAACGTTTGCGAGAGAAGGATAAGCACATTGAAGA
AGTGCGGAAGAACAAAGAATCCAAAGACCCTGCTGACGAGACTGAAGCTGACTAATTTGT
TCTGAGAACTGACTTTCTCCCCATCCCCTTCCTAAATATCCAAAGACTGTACTGGCCAGT
GTCATTTTATTTTTTCCCTCCTGACAAATATTTTAGAAGCTAATGTAGGACTGTATAGGT
AGATCCAGATCCAGACTGTAAGATGTTGTTTTAGGGGCTAAAGGGGAGAAACTGAAAGTG
TTTTACTCTTTTTCTAAAGTGTTGGTCTTTCTAATGTAGCTATTTTTCTTGTTGCATCTT
TTCTACTTCAGTACACTTGGTGTACTGGGTTAATGGCTAGTACTGTATTGGCTCTGTGAA
AACATATTTGTGAAAAGAGTATGTAGTGGCTCCTTTTGAACTGTTAGATGCTGAATATCT
GTTCACTTTTCAATCCCAATTCTGTCCCAATCTTACCAGATGCTACTGGACTTGAATGGT
TAATAAGACTGCACAGTGCTGTAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SgfI-MluI     
ACCN NM_203401
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_203401.1, NP_981946.1
RefSeq Size 1730 bp
RefSeq ORF 450 bp
Locus ID 3925
UniProt ID P16949
Protein Pathways MAPK signaling pathway
Gene Summary This gene belongs to the stathmin family of genes. It encodes a ubiquitous cytosolic phosphoprotein proposed to function as an intracellular relay integrating regulatory signals of the cellular environment. The encoded protein is involved in the regulation of the microtubule filament system by destabilizing microtubules. It prevents assembly and promotes disassembly of microtubules. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
Transcript Variant: This variant (1) differs in the 5' UTR and uses an alternate terminal exon, compared to variant 4. The resulting isoform (a) has a shorter and distinct C-terminus, compared to isoform b. Variants 1, 2, and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...