CD59 (NM_203331) Human Untagged Clone

CAT#: SC308124

CD59 (untagged)-Human CD59 molecule, complement regulatory protein (CD59), transcript variant 4



  "NM_203331" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
CD59 mouse monoclonal antibody, clone OTI2E11 (formerly 2E11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 1F5; 16.3A5; EJ16; EJ30; EL32; G344; HRF-20; HRF20; MAC-IP; MACIF; MEM43; MIC11; MIN1; MIN2; MIN3; MIRL; MSK21; p18-20
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_203331, the custom clone sequence may differ by one or more nucleotides
ATGGGAATCCAAGGAGGGTCTGTCCTGTTCGGGCTGCTGCTCGTCCTGGCTGTCTTCTGC
CATTCAGGTCATAGCCTGCAGTGCTACAACTGTCCTAACCCAACTGCTGACTGCAAAACA
GCCGTCAATTGTTCATCTGATTTTGATGCGTGTCTCATTACCAAAGCTGGGTTACAAGTG
TATAACAAGTGTTGGAAGTTTGAGCATTGCAATTTCAACGACGTCACAACCCGCTTGAGG
GAAAATGAGCTAACGTACTACTGCTGCAAGAAGGACCTGTGTAACTTTAACGAACAGCTT
GAAAATGGTGGGACATCCTTATCAGAGAAAACAGTTCTTCTGCTGGTGACTCCATTTCTG
GCAGCAGCCTGGAGCCTTCATCCCTAA
Restriction Sites Please inquire     
ACCN NM_203331
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_203331.1, NP_976076.1
RefSeq Size 7678 bp
RefSeq ORF 387 bp
Locus ID 966
UniProt ID P13987
Protein Families Druggable Genome
Protein Pathways Complement and coagulation cascades, Hematopoietic cell lineage
Gene Summary This gene encodes a cell surface glycoprotein that regulates complement-mediated cell lysis, and it is involved in lymphocyte signal transduction. This protein is a potent inhibitor of the complement membrane attack complex, whereby it binds complement C8 and/or C9 during the assembly of this complex, thereby inhibiting the incorporation of multiple copies of C9 into the complex, which is necessary for osmolytic pore formation. This protein also plays a role in signal transduction pathways in the activation of T cells. Mutations in this gene cause CD59 deficiency, a disease resulting in hemolytic anemia and thrombosis, and which causes cerebral infarction. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. All variants (1-8) encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...