CD59 (NM_203331) Human Untagged Clone
CAT#: SC308124
CD59 (untagged)-Human CD59 molecule, complement regulatory protein (CD59), transcript variant 4
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 1F5; 16.3A5; EJ16; EJ30; EL32; G344; HRF-20; HRF20; MAC-IP; MACIF; MEM43; MIC11; MIN1; MIN2; MIN3; MIRL; MSK21; p18-20 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_203331, the custom clone sequence may differ by one or more nucleotides
ATGGGAATCCAAGGAGGGTCTGTCCTGTTCGGGCTGCTGCTCGTCCTGGCTGTCTTCTGC CATTCAGGTCATAGCCTGCAGTGCTACAACTGTCCTAACCCAACTGCTGACTGCAAAACA GCCGTCAATTGTTCATCTGATTTTGATGCGTGTCTCATTACCAAAGCTGGGTTACAAGTG TATAACAAGTGTTGGAAGTTTGAGCATTGCAATTTCAACGACGTCACAACCCGCTTGAGG GAAAATGAGCTAACGTACTACTGCTGCAAGAAGGACCTGTGTAACTTTAACGAACAGCTT GAAAATGGTGGGACATCCTTATCAGAGAAAACAGTTCTTCTGCTGGTGACTCCATTTCTG GCAGCAGCCTGGAGCCTTCATCCCTAA |
Restriction Sites | Please inquire |
ACCN | NM_203331 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_203331.1, NP_976076.1 |
RefSeq Size | 7678 bp |
RefSeq ORF | 387 bp |
Locus ID | 966 |
UniProt ID | P13987 |
Protein Families | Druggable Genome |
Protein Pathways | Complement and coagulation cascades, Hematopoietic cell lineage |
Gene Summary | This gene encodes a cell surface glycoprotein that regulates complement-mediated cell lysis, and it is involved in lymphocyte signal transduction. This protein is a potent inhibitor of the complement membrane attack complex, whereby it binds complement C8 and/or C9 during the assembly of this complex, thereby inhibiting the incorporation of multiple copies of C9 into the complex, which is necessary for osmolytic pore formation. This protein also plays a role in signal transduction pathways in the activation of T cells. Mutations in this gene cause CD59 deficiency, a disease resulting in hemolytic anemia and thrombosis, and which causes cerebral infarction. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. All variants (1-8) encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215985 | CD59 (Myc-DDK-tagged)-Human CD59 molecule, complement regulatory protein (CD59), transcript variant 4 |
CNY 1,200.00 |
|
RC215985L3 | Lenti-ORF clone of CD59 (Myc-DDK-tagged)-Human CD59 molecule, complement regulatory protein (CD59), transcript variant 4 |
CNY 5,890.00 |
|
RC215985L4 | Lenti-ORF clone of CD59 (mGFP-tagged)-Human CD59 molecule, complement regulatory protein (CD59), transcript variant 4 |
CNY 5,890.00 |
|
RG215985 | CD59 (tGFP-tagged) - Human CD59 molecule, complement regulatory protein (CD59), transcript variant 4 |
CNY 4,370.00 |