PVRL1 (NECTIN1) (NM_203286) Human Untagged Clone
CAT#: SC308098
PVRL1 (untagged)-Human poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1), transcript variant 3
CNY 5,700.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD111; CLPED1; ED4; HIgR; HV1S; HVEC; nectin-1; OFC7; PRR; PRR1; PVRL1; PVRR; PVRR1; SK-12 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC308098 representing NM_203286.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTCGGATGGGGCTTGCGGGCGCCGCTGGACGCTGGTGGGGACTCGCTCTCGGCTTGACCGCATTC TTCCTCCCAGGCGTCCACTCCCAGGTGGTCCAGGTGAACGACTCCATGTATGGCTTCATCGGCACAGAC GTGGTTCTGCACTGCAGCTTTGCCAACCCGCTTCCCAGCGTGAAGATCACCCAGGTCACATGGCAGAAG TCCACCAATGGCTCCAAGCAGAACGTGGCCATCTACAACCCATCCATGGGCGTGTCCGTGCTGGCTCCC TACCGCGAGCGTGTGGAATTCCTGCGGCCCTCCTTCACCGATGGCACTATCCGCCTCTCCCGCCTGGAG CTGGAGGATGAGGGTGTCTACATCTGCGAGTTTGCTACCTTCCCTACGGGCAATCGAGAAAGCCAGCTC AATCTCACGGTGATGGCCAAACCCACCAATTGGATAGAGGGTACCCAGGCAGTGCTTCGAGCCAAGAAG GGGCAGGATGACAAGGTCCTGGTGGCCACCTGCACCTCAGCCAATGGGAAGCCTCCCAGTGTGGTATCC TGGGAAACTCGGTTAAAAGGTGAGGCAGAGTACCAGGAGATCCGGAACCCCAATGGCACAGTGACGGTC ATCAGCCGCTACCGCCTGGTGCCCAGCAGGGAAGCCCACCAGCAGTCCTTGGCCTGCATCGTCAACTAC CACATGGACCGCTTCAAGGAAAGCCTCACTCTCAACGTGCAGTATGAGCCTGAGGTAACCATTGAGGGG TTTGATGGCAACTGGTACCTGCAGCGGATGGACGTGAAGCTCACCTGCAAAGCTGATGCTAACCCCCCA GCCACTGAGTACCACTGGACCACGCTAAATGGCTCTCTCCCCAAGGGTGTGGAGGCCCAGAACAGAACC CTCTTCTTCAAGGGACCCATCAACTACAGCCTGGCAGGGACCTACATCTGTGAGGCCACCAACCCCATC GGTACACGCTCAGGCCAGGTGGAGGTCAATATCACAGCTTTCTGTCAACTTATCTATCCGGGCAAAGGG AGGACAAGAGCTAGGATGTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_203286 |
Insert Size | 1059 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_203286.1 |
RefSeq Size | 1451 bp |
RefSeq ORF | 1059 bp |
Locus ID | 5818 |
UniProt ID | Q15223 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transmembrane |
Protein Pathways | Adherens junction, Cell adhesion molecules (CAMs) |
MW | 39.1 kDa |
Gene Summary | This gene encodes an adhesion protein that plays a role in the organization of adherens junctions and tight junctions in epithelial and endothelial cells. The protein is a calcium(2+)-independent cell-cell adhesion molecule that belongs to the immunoglobulin superfamily and has 3 extracellular immunoglobulin-like loops, a single transmembrane domain (in some isoforms), and a cytoplasmic region. This protein acts as a receptor for glycoprotein D (gD) of herpes simplex viruses 1 and 2 (HSV-1, HSV-2), and pseudorabies virus (PRV) and mediates viral entry into epithelial and neuronal cells. Mutations in this gene cause cleft lip and palate/ectodermal dysplasia 1 syndrome (CLPED1) as well as non-syndromic cleft lip with or without cleft palate (CL/P). Alternative splicing results in multiple transcript variants encoding proteins with distinct C-termini. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (3) uses an alternate exon for its 3' end, compared to variant 1, resulting in a protein (isoform 3; also known as isoform Gamma) with a shorter and distinct C-terminus, compared to isoform 1. In contrast to isoforms 1 and 2, isoform 3 may be a soluble protein since it is predicted to lack a transmembrane domain. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215930 | PVRL1 (Myc-DDK-tagged)-Human poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1), transcript variant 3 |
CNY 3,656.00 |
|
RC215930L3 | Lenti ORF clone of Human poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215930L4 | Lenti ORF clone of Human poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG215930 | PVRL1 (tGFP-tagged) - Human poliovirus receptor-related 1 (herpesvirus entry mediator C) (PVRL1), transcript variant 3 |
CNY 4,370.00 |