TEAD4 (NM_201441) Human Untagged Clone

CAT#: SC308033

TEAD4 (untagged)-Human TEA domain family member 4 (TEAD4), transcript variant 2



  "NM_201441" in other vectors (4)

CNY 3,656.00

CNY 6,370.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-TEAD4 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EFTR-2; hRTEF-1B; RTEF1; TCF13L1; TEF-3; TEF3; TEFR-1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_201441 edited
TTGGAGGGCACGGCCGGCACCATTACCTCCAACGAGTGGAGCTCTCCCACCTCCCCTGAG
GGGAGCACCGCCTCTGGGGGCAGTCAGGCACTGGACAAGCCCATCGACAATGACGCAGAG
GGCGTGTGGAGCCCGGATATTGAGCAGAGTTTCCAGGAGGCCCTCGCCATCTACCCGCCC
TGTGGCAGGCGCAAAATCATCCTGTCGGACGAGGGCAAGATGTATGGTCGGAACGAGCTG
ATTGCCCGCTACATCAAGCTCCGGACAGGGAAGACCCGCACCAGGAAGCAGGTCTCCAGC
CACATCCAGGTGCTGGCTCGTCGCAAAGCTCGCGAGATCCAGGCCAAGCTAAAGTTTTGG
CAAGGAGCTTTGCCAGGCCAAGCCGGAACGTCCCATGATGTGAAGCCTTTCTCTCAGCAA
ACCTATGCTGTCCAGCCTCCGCTGCCTCTGCCAGGGTTTGAGTCTCCTGCAGGGCCCGCC
CCATCGCCCTCTGCGCCCCCGGCACCCCCATGGCAGGGCCGCAGCGTGGCCAGCTCCAAG
CTCTGGATGTTGGAGTTCTCTGCCTTCCTGGAGCAGCAGCAGGACCCGGACACGTACAAC
AAGCACCTGTTCGTGCACATTGGCCAGTCCAGCCCAAGCTACAGCGACCCCTACCTCGAA
GCCGTGGACATCCGCCAAATCTATGACAAATTCCCGGAGAAAAAGGGTGGACTCAAGGAT
CTCTTCGAACGGGGACCCTCCAATGCCTTTTTTCTTGTGAAGTTCTGGGCAGACCTCAAC
ACCAACATCGAGGATGAAGGCAGCTCCTTCTATGGGGTCTCCAGCCAGTATGAGAGCCCC
GAGAACATGATCATCACCTGCTCCACGAAGGTCTGCTCTTTCGGCAAGCAGGTGGTGGAG
AAAGTTGAGACAGAGTATGCTCGCTATGAGAATGGACACTACTCTTACCGCATCCACCGG
TCCCCGCTCTGTGAGTACATGATCAACTTCATCCACAAGCTCAAGCACCTCCCTGAGAAG
TACATGATGAACAGCGTGCTGGAGAACTTCACCATCCTGCAGGTGGTCACCAACAGAGAC
ACACAGGAGACCTTGCTGTGCATTGCCTATGTCTTTGAGGTGTCAGCCAGTGAGCACGGG
GCTCAGCACCACATCTACAGGCTGGTGAAAGAATGA
Restriction Sites Please inquire     
ACCN NM_201441
Insert Size 1500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_201441.1, NP_958849.1
RefSeq Size 1651 bp
RefSeq ORF 1176 bp
Locus ID 7004
UniProt ID Q15561
Protein Families Transcription Factors
Gene Summary This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is preferentially expressed in the skeletal muscle, and binds to the M-CAT regulatory element found in promoters of muscle-specific genes to direct their gene expression. Alternatively spliced transcripts encoding distinct isoforms, some of which are translated through the use of a non-AUG (UUG) initiation codon, have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1, resulting in an isoform (2) that is missing an internal segment compared to isoform 1. It also initiates translation from a non-AUG (UUG) codon.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...