TEAD4 (NM_201441) Human Untagged Clone
CAT#: SC308033
TEAD4 (untagged)-Human TEA domain family member 4 (TEAD4), transcript variant 2
CNY 3,656.00
CNY 6,370.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EFTR-2; hRTEF-1B; RTEF1; TCF13L1; TEF-3; TEF3; TEFR-1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_201441 edited
TTGGAGGGCACGGCCGGCACCATTACCTCCAACGAGTGGAGCTCTCCCACCTCCCCTGAG GGGAGCACCGCCTCTGGGGGCAGTCAGGCACTGGACAAGCCCATCGACAATGACGCAGAG GGCGTGTGGAGCCCGGATATTGAGCAGAGTTTCCAGGAGGCCCTCGCCATCTACCCGCCC TGTGGCAGGCGCAAAATCATCCTGTCGGACGAGGGCAAGATGTATGGTCGGAACGAGCTG ATTGCCCGCTACATCAAGCTCCGGACAGGGAAGACCCGCACCAGGAAGCAGGTCTCCAGC CACATCCAGGTGCTGGCTCGTCGCAAAGCTCGCGAGATCCAGGCCAAGCTAAAGTTTTGG CAAGGAGCTTTGCCAGGCCAAGCCGGAACGTCCCATGATGTGAAGCCTTTCTCTCAGCAA ACCTATGCTGTCCAGCCTCCGCTGCCTCTGCCAGGGTTTGAGTCTCCTGCAGGGCCCGCC CCATCGCCCTCTGCGCCCCCGGCACCCCCATGGCAGGGCCGCAGCGTGGCCAGCTCCAAG CTCTGGATGTTGGAGTTCTCTGCCTTCCTGGAGCAGCAGCAGGACCCGGACACGTACAAC AAGCACCTGTTCGTGCACATTGGCCAGTCCAGCCCAAGCTACAGCGACCCCTACCTCGAA GCCGTGGACATCCGCCAAATCTATGACAAATTCCCGGAGAAAAAGGGTGGACTCAAGGAT CTCTTCGAACGGGGACCCTCCAATGCCTTTTTTCTTGTGAAGTTCTGGGCAGACCTCAAC ACCAACATCGAGGATGAAGGCAGCTCCTTCTATGGGGTCTCCAGCCAGTATGAGAGCCCC GAGAACATGATCATCACCTGCTCCACGAAGGTCTGCTCTTTCGGCAAGCAGGTGGTGGAG AAAGTTGAGACAGAGTATGCTCGCTATGAGAATGGACACTACTCTTACCGCATCCACCGG TCCCCGCTCTGTGAGTACATGATCAACTTCATCCACAAGCTCAAGCACCTCCCTGAGAAG TACATGATGAACAGCGTGCTGGAGAACTTCACCATCCTGCAGGTGGTCACCAACAGAGAC ACACAGGAGACCTTGCTGTGCATTGCCTATGTCTTTGAGGTGTCAGCCAGTGAGCACGGG GCTCAGCACCACATCTACAGGCTGGTGAAAGAATGA |
Restriction Sites | Please inquire |
ACCN | NM_201441 |
Insert Size | 1500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_201441.1, NP_958849.1 |
RefSeq Size | 1651 bp |
RefSeq ORF | 1176 bp |
Locus ID | 7004 |
UniProt ID | Q15561 |
Protein Families | Transcription Factors |
Gene Summary | This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is preferentially expressed in the skeletal muscle, and binds to the M-CAT regulatory element found in promoters of muscle-specific genes to direct their gene expression. Alternatively spliced transcripts encoding distinct isoforms, some of which are translated through the use of a non-AUG (UUG) initiation codon, have been described for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1, resulting in an isoform (2) that is missing an internal segment compared to isoform 1. It also initiates translation from a non-AUG (UUG) codon. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218693 | TEAD4 (Myc-DDK-tagged)-Human TEA domain family member 4 (TEAD4), transcript variant 2 |
CNY 3,656.00 |
|
RC218693L3 | Lenti ORF clone of Human TEA domain family member 4 (TEAD4), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC218693L4 | Lenti ORF clone of Human TEA domain family member 4 (TEAD4), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG218693 | TEAD4 (tGFP-tagged) - Human TEA domain family member 4 (TEAD4), transcript variant 2 |
CNY 4,370.00 |