United States
Germany
Japan
United Kingdom
China
Claudin 8 (CLDN8) (NM_199328) Human Untagged Clone
CAT＃: SC307933
CLDN8 (untagged)-Human claudin 8 (CLDN8)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HEL-S-79 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC307933 representing NM_199328.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAACCCATGCCTTAGAAATCGCTGGGCTGTTTCTTGGTGGTGTTGGAATGGTGGGCACAGTGGCT GTCACTGTCATGCCTCAGTGGAGAGTGTCGGCCTTCATTGAAAACAACATCGTGGTTTTTGAAAACTTC TGGGAAGGACTGTGGATGAATTGCGTGAGGCAGGCTAACATCAGGATGCAGTGCAAAATCTATGATTCC CTGCTGGCTCTTTCTCCGGACCTACAGGCAGCCAGAGGACTGATGTGTGCTGCTTCCGTGATGTCCTTC TTGGCTTTCATGATGGCCATCCTTGGCATGAAATGCACCAGGTGCACGGGGGACAATGAGAAGGTGAAG GCTCACATTCTGCTGACGGCTGGAATCATCTTCATCATCACGGGCATGGTGGTGCTCATCCCTGTGAGC TGGGTTGCCAATGCCATCATCAGAGATTTCTATAACTCAATAGTGAATGTTGCCCAAAAACGTGAGCTT GGAGAAGCTCTCTACTTAGGATGGACCACGGCACTGGTGCTGATTGTTGGAGGAGCTCTGTTCTGCTGC GTTTTTTGTTGCAACGAAAAGAGCAGTAGCTACAGATACTCGATACCTTCCCATCGCACAACCCAAAAA AGTTATCACACCGGAAAGAAGTCACCGAGCGTCTACTCCAGAAGTCAGTATGTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_199328 |
| Insert Size | 678 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_199328.2 |
| RefSeq Size | 2147 bp |
| RefSeq ORF | 678 bp |
| Locus ID | 9073 |
| UniProt ID | P56748 |
| Protein Families | Transmembrane |
| Protein Pathways | Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction |
| MW | 24.8 kDa |
| Gene Summary | This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This protein plays important roles in the paracellular cation barrier of the distal renal tubule, and in the paracellular barrier to prevent sodium back-leakage in distal colon. Differential expression of this gene has been observed in colorectal carcinoma and renal cell tumors, and along with claudin-7, is an immunohistochemical marker for the differential diagnosis of chromophobe renal cell carcinoma and renal oncocytoma.[provided by RefSeq, May 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208853 | CLDN8 (Myc-DDK-tagged)-Human claudin 8 (CLDN8) |
CNY 2,400.00 |
|
| RC208853L1 | Lenti ORF clone of Human claudin 8 (CLDN8), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC208853L2 | Lenti ORF clone of Human claudin 8 (CLDN8), mGFP tagged |
CNY 5,890.00 |
|
| RC208853L3 | Lenti ORF clone of Human claudin 8 (CLDN8), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC208853L4 | Lenti ORF clone of Human claudin 8 (CLDN8), mGFP tagged |
CNY 4,800.00 |
|
| RG208853 | CLDN8 (tGFP-tagged) - Human claudin 8 (CLDN8) |
CNY 4,000.00 |
|
| SC320974 | CLDN8 (untagged)-Human claudin 8 (CLDN8) |
CNY 2,400.00 |
其它Claudin 8产品
