RNF138 (NM_198128) Human Untagged Clone
CAT#: SC307631
RNF138 (untagged)-Human ring finger protein 138 (RNF138), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | hNARF; HSD-4; NARF; STRIN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307631 representing NM_198128.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCGAGGACCTCTCTGCGGCCACGTCCTACACCGAAGATGATTTCTACTGCCCCGTCTGTCAGGAG GTGCTCAAAACGCCCGTGCGGACCACGGCCTGTCAGCACGTCAATAGGAGTGAAACATCCACATCTGAT AACACAGAAACTTACCAAGAGAATACAAGTTCTTCTGGTCATCCTACTTTTAAGTGTCCCCTGTGTCAA GAATCAAATTTTACCAGACAGCGTTTACTGGATCACTGTAACAGTAATCACCTATTTCAGATAGTTCCT GTGACATGTCCTATTTGTGTGTCTCTTCCTTGGGGAGATCCTAGCCAGATTACCAGAAATTTCGTTAGT CATCTAAATCAGAGACATCAATTTGATTATGGAGAATTTGTGAATCTTCAGCTAGATGAAGAAACCCAA TACCAAACTGCTGTTGAAGAATCTTTTCAAGTAAACATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_198128 |
Insert Size | 456 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_198128.2 |
RefSeq Size | 3016 bp |
RefSeq ORF | 456 bp |
Locus ID | 51444 |
UniProt ID | Q8WVD3 |
MW | 17.3 kDa |
Gene Summary | The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR and lacks two alternate in-frame exons compared to variant 1. The resulting protein (isoform 2) is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220106 | RNF138 (Myc-DDK-tagged)-Human ring finger protein 138 (RNF138), transcript variant 2 |
CNY 1,200.00 |
|
RC220106L3 | Lenti ORF clone of Human ring finger protein 138 (RNF138), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220106L4 | Lenti ORF clone of Human ring finger protein 138 (RNF138), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG220106 | RNF138 (tGFP-tagged) - Human ring finger protein 138 (RNF138), transcript variant 2 |
CNY 4,370.00 |