ROC2 (RNF7) (NM_183237) Human Untagged Clone
CAT#: SC307562
RNF7 (untagged)-Human ring finger protein 7 (RNF7), transcript variant 3
CN¥ 3,990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CKBBP1; rbx2; ROC2; SAG |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_183237, the custom clone sequence may differ by one or more nucleotides
ATGGCCGACGTGGAAGACGGAGAGGAAACCTGCGCCCTGGCCTCTCACTCCGGGAGCTCA GGCTCCAAGTCGGGAGGCGACAAGATGTTCTCCCTCAAGAAGTGGAACGCGGTGGCCATG TGGAGCTGGGACGTGGAGTGCGATACGTGCGCCATCTGCAGGGTCCAGATGCCTGTCTTA GATGTCAAGCTGAAAACAAACAAGAGGACTGTGTTGTGGTCTGGGGAGAATGTAATCATT CCTTCCACAACTGCTGCATGTCCCTGTGGGTGA |
Restriction Sites | Please inquire |
ACCN | NM_183237 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_183237.1, NP_899060.1 |
RefSeq Size | 1609 bp |
RefSeq ORF | 273 bp |
Locus ID | 9616 |
UniProt ID | Q9UBF6 |
Protein Families | Druggable Genome |
Protein Pathways | Ubiquitin mediated proteolysis |
Gene Summary | The protein encoded by this gene is a highly conserved ring finger protein. It is an essential subunit of SKP1-cullin/CDC53-F box protein ubiquitin ligases, which are a part of the protein degradation machinery important for cell cycle progression and signal transduction. This protein interacts with, and is a substrate of, casein kinase II (CSNK2A1/CKII). The phosphorylation of this protein by CSNK2A1 has been shown to promote the degradation of IkappaBalpha (CHUK/IKK-alpha/IKBKA) and p27Kip1(CDKN1B). Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) uses an alternate splice site in the coding region compared to variant 1, which causes a frameshift. The resulting shorter isoform (3) has a distinct C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222363 | RNF7 (Myc-DDK-tagged)-Human ring finger protein 7 (RNF7), transcript variant 3 |
CN¥ 3,990.00 |
|
RC222363L3 | Lenti-ORF clone of RNF7 (Myc-DDK-tagged)-Human ring finger protein 7 (RNF7), transcript variant 3 |
CN¥ 5,890.00 |
|
RC222363L4 | Lenti-ORF clone of RNF7 (mGFP-tagged)-Human ring finger protein 7 (RNF7), transcript variant 3 |
CN¥ 5,890.00 |
|
RG222363 | RNF7 (tGFP-tagged) - Human ring finger protein 7 (RNF7), transcript variant 3 |
CN¥ 2,920.00 |