GPX6 (NM_182701) Human Untagged Clone
CAT#: SC307486
GPX6 (untagged)-Human glutathione peroxidase 6 (olfactory) (GPX6) (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
CNY 3,816.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Synonyms | dJ1186N24; dJ1186N24.1; GPx-6; GPX5p; GPXP3; GSHPx-6 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_182701 edited
GTCGTCTAAAACTCCTAGCCATGTTCCAGCAGTTCCAGGCCTCCTGTCTTGTCCTGTTTT TCCTGGTTGGCTTTGCTCAGCAGACCCTAAAGCCTCAAAATAGGAAGGTGGATTGCAACA AAGGGGTAACAGGCACCATCTATGAGTATGGAGCCCTCACCCTCAACGGCGAGGAGTACA TCCAATTCAAGCAGTTTGCAGGCAAGCACGTCCTGTTTGTCAATGTGGCCGCCTATTGAG GCTTGGCAGCTCAGTATCCTGAACTGAATGCACTACAGGAGGAGCTGAAGAATTTTGGTG TCATTGTGTTGGCCTTTCCCTGCAACCAGTTTGGAAAACAAGAACCAGGAACAAACTCAG AAATACTTCTTGGTCTCAAGTATGTGTGTCCAGGTAGTGGCTTTGTCCCCAGTTTCCAGC TCTTTGAGAAAGGGGATGTGAATGGAGAAAAAGAACAGAAGGTCTTTACTTTCCTGAAGA ACTCCTGCCCTCCGACCTCTGATCTTTTGGGCTCATCAAGCCAACTCTTCTGGGAGCCCA TGAAGGTCCATGATATCCGCTGGAACTTTGAGAAATTTCTGGTGGGGCCCGATGGAGTCC CTGTCATGCATTGGTTCCACCAGGCTCCAGTCAGCACAGTCAAGTCAGACATCCTGGAGT ACCTAAAGCAGTTCAATACCCACTAGGAAGGGCTAGCGACTGACAGAAATAACTACCCTG TCTCCCACCTGCAGGAATGTCTAACAAAGCATCCATCTTCCTCCTTCTTTGCTCCACACT CGTGCCTACCCAGCCTCCTGATGACCAAACCATCCTGTACTACCCAAGCACCTGCTTAGC ATGTGTGTGTAGCTGTGTGTGTGTGTG |
Restriction Sites | Please inquire |
ACCN | NM_182701 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_182701.1, NP_874360.1 |
RefSeq Size | 1712 bp |
Locus ID | 257202 |
UniProt ID | P59796 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Arachidonic acid metabolism, Glutathione metabolism |
Gene Summary | The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. Expression of this gene has been observed in embryos and olfactory epithelium; however, the exact function of this gene is not known. This isozyme is a selenoprotein in humans, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The orthologs of this gene in mouse and rat (and some other species) contain a cysteine (Cys) residue in place of the Sec residue, and their corresponding mRNAs lack SECIS element. [provided by RefSeq, Jul 2017] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224313 | GPX6 (Myc-DDK-tagged)-Human glutathione peroxidase 6 (olfactory) (GPX6), (Note, selenocysteine protein, internal stop codon, see reference data summary) |
CNY 2,400.00 |
|
RC224313L1 | Lenti-ORF, GPX6 (Myc-DDK-tagged)-Human glutathione peroxidase 6 (olfactory) (GPX6), (Note, selenocystein protein, internal stop codon, see summary) |
CNY 4,800.00 |
|
RG224313 | GPX6 (GFP-tagged) - Human glutathione peroxidase 6 (olfactory) (GPX6), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 4,000.00 |