AMELX (NM_182681) Human Untagged Clone
CAT#: SC307481
AMELX (untagged)-Human amelogenin, X-linked (AMELX), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AI1E; AIH1; ALGN; AMG; AMGL; AMGX |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307481 representing NM_182681.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGACCTGGATTTTATTTGCCTGCCTCCTGGGAGCAGCTTTTGCCATGCCTGTGCTTACCCCTTTG AAGTGGTACCAGAGCATAAGGCCACCGTACCCTTCCTATGGTTACGAGCCCATGGGTGGATGGCTGCAC CACCAAATCATCCCCGTGCTGTCCCAACAGCACCCCCCGACTCACACCCTGCAGCCTCATCACCACATC CCAGTGGTGCCAGCTCAGCAGCCCGTGATCCCCCAGCAACCAATGATGCCCGTTCCTGGCCAACACTCC ATGACTCCAATCCAACACCACCAGCCAAACCTCCCTCCGCCCGCCCAGCAGCCCTACCAGCCCCAGCCT GTTCAGCCACAGCCTCACCAGCCCATGCAGCCCCAGCCACCTGTGCACCCCATGCAGCCCCTGCCGCCA CAGCCACCTCTGCCTCCGATGTTCCCCATGCAGCCCCTGCCTCCCATGCTTCCTGATCTGACTCTGGAA GCTTGGCCATCAACAGACAAGACCAAGCGGGAGGAAGTGGATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_182681 |
Insert Size | 528 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_182681.1 |
RefSeq Size | 745 bp |
RefSeq ORF | 528 bp |
Locus ID | 265 |
UniProt ID | Q99217 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
MW | 19.8 kDa |
Gene Summary | This gene encodes a member of the amelogenin family of extracellular matrix proteins. Amelogenins are involved in biomineralization during tooth enamel development. Mutations in this gene cause X-linked amelogenesis imperfecta. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks two in-frame exons in the coding region, compared to variant 3. Isoform 2 is shorter than isoform 3. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215005 | AMELX (Myc-DDK-tagged)-Human amelogenin, X-linked (AMELX), transcript variant 2 |
CNY 2,400.00 |
|
RC215005L3 | Lenti ORF clone of Human amelogenin, X-linked (AMELX), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215005L4 | Lenti ORF clone of Human amelogenin, X-linked (AMELX), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG215005 | AMELX (tGFP-tagged) - Human amelogenin, X-linked (AMELX), transcript variant 2 |
CNY 4,370.00 |