United States
Germany
Japan
United Kingdom
China
UBE2E1 (NM_182666) Human Untagged Clone
CAT＃: SC307478
UBE2E1 (untagged)-Human ubiquitin-conjugating enzyme E2E 1 (UBE2E1), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | UBCH6 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC307478 representing NM_182666.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGGATGACGATTCGAGGGCCAGCACCAGCTCCTCCTCATCTTCGTCTTCCAACCAGCAAACCGAG AAAGAAACAAACACCCCCAAGAAGAAGGAGAGTAAAGTCAGCATGAGCAAAAACTCCAAACTCCTCTCC ACCAGCGCCAAGAGTGCTGGTCCCAAAGGCGATAACATCTATGAATGGAGATCAACCATTCTAGGGCCT CCAGGATCCGTGTATGAGGGTGGTGTATTCTTTCTCGATATCACTTTTACACCAGAATATCCCTTCAAG CCTCCAAAGGTTACATTTCGGACAAGAATCTATCATTGTAATATTAACAGTCAAGGTGTTATTTGCTTG GACATATTGAAAGATAATTGGAGTCCAGCACTAACCATTTCTAAAGTCCTCCTTTCTATCTGCTCACTT CTTACAGACTGTAATCCTGCCGACCCCTTGGTGGGAAGTATTGCCACTCAGTATATGACCAACAGAGCA GAACATGACAGAATGGCCAGACAGTGGACCAAGAGATACGCTACATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_182666 |
| Insert Size | 531 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_182666.2 |
| RefSeq Size | 1794 bp |
| RefSeq ORF | 531 bp |
| Locus ID | 7324 |
| UniProt ID | P51965 |
| Protein Pathways | Ubiquitin mediated proteolysis |
| MW | 19.5 kDa |
| Gene Summary | The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (2) lacks an in-frame exon and thus encodes a shorter isoform (2), as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214934 | UBE2E1 (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2E 1 (UBE2E1), transcript variant 2 |
CNY 2,400.00 |
|
| RC214934L3 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2E 1 (UBE2E1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC214934L4 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2E 1 (UBE2E1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG214934 | UBE2E1 (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2E 1 (UBE2E1), transcript variant 2 |
CNY 4,370.00 |
