United States
Germany
Japan
United Kingdom
China
PTF1A (NM_178161) Human Untagged Clone
CAT＃: SC307134
PTF1A (untagged)-Human pancreas specific transcription factor, 1a (PTF1A)
CNY 3,600.00
| Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | bHLHa29; p48; PACA; PAGEN2; PTF1-p48 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_178161 edited
ATGGACGCGGTGTTGCTGGAGCACTTCCCCGGGGGCCTAGACGCCTTTCCTTCTTCGTAC TTCGACGAGGACGACTTCTTCACCGACCAGTCTTCACGGGACCCCCTGGAGGACGGCGAT GAGCTGCTGGCGGACGAGCAGGCCGAGGTGGAGTTCCTTAGCCACCAGCTCCACGAGTAC TGCTACCGCGACGGGGCGTGCCTGCTGCTGCAGCCCGCGCCCCCGGCCGCCCCGCTAGCG CTCGCCCCGCCGTCCTCGGGGGGCCTCGGTGAGCCAGACGACGGCGGCGGCGGCGGCTAC TGCTGCGAGACGGGGGCGCCCCCAGGCGGCTTCCCCTACTCGCCCGGCTCGCCGCCCTCG TGCCTGGCCTACCCGTGCGCCGGGGCGGCAGTACTGTCTCCCGGGGCGCGGCTGCGCGGC CTGAGCGGAGCGGCGGCTGCGGCGGCGCGGCGCCGGCGGCGGGTGCGCTCCGAGGCGGAG CTGCAGCAGCTGCGGCAGGCGGCCAACGTGCGCGAGCGGCGGCGCATGCAGTCCATCAAC GACGCCTTCGAGGGGCTGCGCTCGCACATCCCCACGCTGCCCTACGAGAAGCGCCTCTCC AAGGTGGACACGCTGCGCCTGGCCATCGGCTACATCAACTTCCTCAGCGAGCTCGTGCAG GCCGACCTGCCCTTGCGCGGCGGTGGCGCGGGCGGCTGCGGGGGGCCGGGCGGCGGCGGG CGCCTGGGCGGGGACAGCCCGGGCAGCCAGGCCCAGAAGGTCATCATCTGCCATCGGGGC ACCCGGTCCCCCTCCCCCAGCGACCCTGATTATGGCCTCCCTCCCCTAGCAGGACACTCT CTCTCATGGACTGATGAAAAACAACTCAAGGAACAAAATATTATCCGAACAGCCAAAGTC TGGACCCCAGAGGACCCCAGAAAACTCAACAGCAAATCTTCCTTCAACAACATAGAAAAC GAACCACCATTTGAGTTTGTGTCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_178161 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_178161.1, NP_835455.1 |
| RefSeq Size | 987 bp |
| RefSeq ORF | 987 bp |
| Locus ID | 256297 |
| UniProt ID | Q7RTS3 |
| Protein Families | Embryonic stem cells, ES Cell Differentiation/IPS |
| Gene Summary | This gene encodes a protein that is a component of the pancreas transcription factor 1 complex (PTF1) and is known to have a role in mammalian pancreatic development. The protein plays a role in determining whether cells allocated to the pancreatic buds continue towards pancreatic organogenesis or revert back to duodenal fates. The protein is thought to be involved in the maintenance of exocrine pancreas-specific gene expression including elastase 1 and amylase. Mutations in this gene cause cerebellar agenesis and loss of expression is seen in ductal type pancreas cancers. [provided by RefSeq, Jul 2008] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Functional and association analysis of an Amerindian-derived population-specific p.(Thr280Met) variant in RBPJL, a component of the PTF1 complex
,Nair, AK;Sutherland, JR;Traurig, M;Piaggi, P;Chen, P;Kobes, S;Hanson, RL;Bogardus, C;Baier, LJ;,
Eur. J. Hum. Genet.
,PubMed ID 29302047
[PTF1A]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221496 | PTF1A (Myc-DDK-tagged)-Human pancreas specific transcription factor, 1a (PTF1A) |
CNY 3,600.00 |
|
| RC221496L1 | Lenti ORF clone of Human pancreas specific transcription factor, 1a (PTF1A), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC221496L2 | Lenti ORF clone of Human pancreas specific transcription factor, 1a (PTF1A), mGFP tagged |
CNY 6,000.00 |
|
| RC221496L3 | Lenti ORF clone of Human pancreas specific transcription factor, 1a (PTF1A), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC221496L4 | Lenti ORF clone of Human pancreas specific transcription factor, 1a (PTF1A), mGFP tagged |
CNY 6,000.00 |
|
| RG221496 | PTF1A (tGFP-tagged) - Human pancreas specific transcription factor, 1a (PTF1A) |
CNY 5,200.00 |
