PPAP2C (PLPP2) (NM_177543) Human Untagged Clone

CAT#: SC307107

PPAP2C (untagged)-Human phosphatidic acid phosphatase type 2C (PPAP2C), transcript variant 3



  "NM_177543" in other vectors (4)

CN¥ 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


PLPP2 rabbit polyclonal antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LPP2; PAP-2c; PAP2-g; PPAP2C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307107 representing NM_177543.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGGTCGCGAGAGGCCCGGGGAGCCGGGGCCAGCATCCCCCGCCCCGGCAGCAGGAAGTCTGTGCG
GAGGGGCCGCGCGCGCGCCTCCATCCCGCCCCGCCTGGCCTGGGAGCCTCCCTGCCCTTCGCTATCCTG
ACGCTGGTGAACGCCCCGTACAAGCGAGGATTTTACTGCGGGGATGACTCCATCCGGTACCCCTACCGT
CCAGATACCATCACCCACGGGCTCATGGCTGGGGTCACCATCACGGCCACCGTCATCCTTGTCTCGGCC
GGGGAAGCCTACCTGGTGTACACAGACCGGCTCTATTCTCGCTCGGACTTCAACAACTACGTGGCTGCT
GTATACAAGGTGCTGGGGACCTTCCTGTTTGGGGCTGCCGTGAGCCAGTCTCTGACAGACCTGGCCAAG
TACATGATTGGGCGTCTGAGGCCCAACTTCCTAGCCGTCTGCGACCCCGACTGGAGCCGGGTCAACTGC
TCGGTCTATGTGCAGCTGGAGAAGGTGTGCAGGGGAAACCCTGCTGATGTCACCGAGGCCAGGTTGTCT
TTCTACTCGGGACACTCTTCCTTTGGGATGTACTGCATGGTGTTCTTGGCGCTGTATGTGCAGGCACGA
CTCTGTTGGAAGTGGGCACGGCTGCTGCGACCCACAGTCCAGTTCTTCCTGGTGGCCTTTGCCCTCTAC
GTGGGCTACACCCGCGTGTCTGATTACAAACACCACTGGAGCGATGTCCTTGTTGGCCTCCTGCAGGGG
GCACTGGTGGCTGCCCTCACTGTCTGCTACATCTCAGACTTCTTCAAAGCCCGACCCCCACAGCACTGT
CTGAAGGAGGAGGAGCTGGAACGGAAGCCCAGCCTGTCACTGACGTTGACCCTGGGCGAGGCTGACCAC
AACCACTATGGATACCCGCACTCCTCCTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_177543
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_177543.2
RefSeq Size 1387 bp
RefSeq ORF 930 bp
Locus ID 8612
UniProt ID O43688
Protein Families Druggable Genome, Stem cell - Pluripotency, Transmembrane
Protein Pathways Ether lipid metabolism, Fc gamma R-mediated phagocytosis, Glycerolipid metabolism, Glycerophospholipid metabolism, Metabolic pathways, Sphingolipid metabolism
MW 34.4 kDa
Gene Summary The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. This protein is similar to phosphatidic acid phosphatase type 2A (PPAP2A) and type 2B (PPAP2B). All three proteins contain 6 transmembrane regions, and a consensus N-glycosylation site. This protein has been shown to possess membrane associated PAP activity. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) encodes the longest isoform (3).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...