SULT1A1 (NM_177536) Human Untagged Clone
CAT#: SC307103
SULT1A1 (untagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 5
CN¥ 3,990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HAST1/HAST2; P-PST; P-PST 1; PST; ST1A1; ST1A3; STP; STP1; ts-PST; TSPST1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307103 representing NM_177536.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTGGCCAAGTTGCTGTGCGACCAGGTGGTCGGTGCGCCCATCGCGGTCTCGGCCTTCTACGCCGGT ATGAGCATTCTCCAGGGAAAGGATGACATATTTTTGGACCTGAAACAGAAATTCTGGAACACCTATATG GTGGTCTATGTTGCCCGCAACGCAAAGGATGTGGCAGTTTCCTACTACCACTTCTACCACATGGCCAAG GTGCACCCTGAGCCTGGGACCTGGGACAGCTTCCTGGAGAAGTTCATGGTCGGAGAAGTGTCCTACGGA TCCTGGTACCAGCACGTGCAGGAGTGGTGGGAGCTGAGCCGCACCCACCCTGTTCTCTACCTCTTCTAT GAAGACATGAAGGAGAACCCGAAAAGGGAGATTCAAAAGATCCTGGAGTTTGTGGGGCGCTCCCTGCCA GAGGAGACCGTGGACTTCGTGGTTCAGCACACGTCGTTCAAGGAGATGAAGAAGAACCCTATGACCAAC TACACCACCGTCCCCCAGGAGTTCATGGACCACAGCATCTCCCCCTTCATGAGGAAAGGCATGGCTGGG GACTGGAAGACCACCTTCACCGTGGCGCAGAATGAGCGCTTCGATGCGGACTATGCGGAGAAGATGGCA GGCTGCAGCCTCAGCTTCCGCTCTGAGCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_177536 |
Insert Size | 654 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_177536.3 |
RefSeq Size | 1291 bp |
RefSeq ORF | 654 bp |
Locus ID | 6817 |
UniProt ID | P50225 |
Protein Pathways | Sulfur metabolism |
MW | 25.4 kDa |
Gene Summary | Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes one of two phenol sulfotransferases with thermostable enzyme activity. Multiple alternatively spliced variants that encode two isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (5) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1, which causes the predicted protein (isoform b) to be shorter than isoform a. The predicted ORF of this rare transcript has not been experimentally confirmed. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212313 | SULT1A1 (Myc-DDK-tagged)-Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 5 |
CN¥ 2,400.00 |
|
RC212313L3 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 5, Myc-DDK-tagged |
CN¥ 5,890.00 |
|
RC212313L4 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 5, mGFP tagged |
CN¥ 5,890.00 |
|
RG212313 | SULT1A1 (tGFP-tagged) - Human sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1), transcript variant 5 |
CN¥ 4,370.00 |
其它SULT1A1产品