SSX4 (NM_175729) Human Untagged Clone
CAT#: SC307019
SSX4 (untagged)-Human synovial sarcoma, X breakpoint 4 (SSX4), transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CT5.4 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_175729 edited
ACACGCCGATTTGCCCTTTTGATTCTTCCACAATCAGGGTGAGACTGCTCCCAGTGCCAT GAACGGAGACGACGCCTTTGCAAGGAGACCCAGGGATGATGCTCAAATATCAGAGAAGTT ACGAAAGGCCTTCGATGATATTGCCAAATACTTCTCTAAGAAAGAGTGGGAAAAGATGAA ATCCTCGGAGAAAATCGTCTATGTGTATATGAAGCTAAACTATGAGGTCATGACTAAACT AGGTTTCAAGGTCACCCTCCCACCTTTCATGCGTAGTAAACGGGCTGCAGACTTCCACGG GAATGATTTTGGTAACGATCGAAACCACAGGAATCAGGTTGAACGTCCTCAGATGACTTT CGGCAGCCTCCAGAGAATCTTCCCGAAGGACCCAAAAGGGGGAAACATGCCTGGACCCAC AGACTGCGTGAGAGAAAGCAGCTGGTGGTTTATGAAGAGATCAGCGACCCTGAGGAAGAT GACGAGTAACTCCCCTCGGGGATATGACACATGCCCATGATGAGAAGCAGAACGTGGTGA CCTTTCACGAACATGGGCATGGCTGCGGACCCCTCGTCATCAGGTGCATAGCAAGTGAAA GCAAGTGTTCACAACAGTGAAAAGTTGAGCGTCATTTTTCTTAGTGTGCCAAGAGTTCGA TGTTGGCGTTTCCGCTGTATTTTCTTGCAGTGTGCCATTCTGTTAGACATTAGCGTTTTC GCTGATGAGCAAGACATGCTTAATGCATATTTCGGCTTGTGTATCCATGCACCTACCTCA GAAAACAAGTATTGTCAGGTATTCTCTCCATAGAACAGCACTACCCTCCTCTCTCCCCAG ATGTGACTACTGAGGGGAGGTCTGAGTGTTTAATTTCCGATTTTTTCCTCTGCATTTACA CACACACCACACACGCACACACACACACCAAGTACCAGTATAAGCATCTCCCATCTGCTT TTCTCCATTGCCATGCGTCCTGGTCAAGCCCCCCTCACTCTGTTTCCTGTTCAGCATGTA CTCCCCTCATCCGATTCCGTTGTATCAGTCACTGACAGTTAATAAACCTTTGCAAACGTT CAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_175729 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_175729.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_175729.1, NP_783856.1 |
RefSeq Size | 1114 bp |
RefSeq ORF | 462 bp |
Locus ID | 6759 |
UniProt ID | O60224 |
Protein Families | Transcription Factors |
Gene Summary | The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneously humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. SSX1, SSX2 and SSX4 genes have been involved in the t(X;18) translocation characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. Chromosome Xp11 contains a segmental duplication resulting in two identical copies of synovial sarcoma, X breakpoint 4, SSX4 and SSX4B, in tail-to-tail orientation. This gene, SSX4, represents the more telomeric copy. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks a segment in the coding region which leads to a frameshift, compared to variant 1. The resulting isoform (b) contains a shorter and distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222659 | SSX4 (Myc-DDK-tagged)-Human synovial sarcoma, X breakpoint 4 (SSX4), transcript variant 2 |
CNY 1,200.00 |
|
RC222659L1 | Lenti ORF clone of Human synovial sarcoma, X breakpoint 4 (SSX4), transcript variant 2, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC222659L2 | Lenti ORF clone of Human synovial sarcoma, X breakpoint 4 (SSX4), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC222659L3 | Lenti ORF clone of Human synovial sarcoma, X breakpoint 4 (SSX4), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222659L4 | Lenti ORF clone of Human synovial sarcoma, X breakpoint 4 (SSX4), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG222659 | SSX4 (tGFP-tagged) - Human synovial sarcoma, X breakpoint 4 (SSX4), transcript variant 2 |
CNY 2,800.00 |