IL5RA (NM_175724) Human Untagged Clone
CAT#: SC307015
IL5RA (untagged)-Human interleukin 5 receptor, alpha (IL5RA), transcript variant 2
CN¥ 5,420.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD125; CDw125; HSIL5R3; IL5R |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_175724, the custom clone sequence may differ by one or more nucleotides
ATGATCATCGTGGCGCATGTATTACTCATCCTTTTGGGGGCCACTGAGATACTGCAAGCT GACTTACTTCCTGATGAAAAGATTTCACTTCTCCCACCTGTCAATTTCACCATTAAAGTT ACTGGTTTGGCTCAAGTTCTTTTACAATGGAAACCAAATCCTGATCAAGAGCAAAGGAAT GTTAATCTAGAATATCAAGTGAAAATAAACGCTCCAAAAGAAGATGACTATGAAACCAGA ATCACTGAAAGCAAATGTGTAACCATCCTCCACAAAGGCTTTTCAGCAAGTGTGCGGACC ATCCTGCAGAACGACCACTCACTACTGGCCAGCAGCTGGGCTTCTGCTGAACTTCATGCC CCACCAGGGTCTCCTGGAACCTCAATTGTGAATTTAACTTGCACCACAAACACTACAGAA GACAATTATTCACGTTTAAGGTCATACCAAGTTTCCCTTCACTGCACCTGGCTTGTTGGC ACAGATGCCCCTGAGGACACGCAGTATTTTCTCTACTATAGGTATGGCTCTTGGACTGAA GAATGCCAAGAATACAGCAAAGACACACTGGGGAGAAATATCGCATGCTGGTTTCCCAGG ACTTTTATCCTCAGCAAAGGGCGTGACTGGCTTGCGGTGCTTGTTAACGGCTCCAGCAAG CACTCTGCTATCAGGCCCTTTGATCAGCTGTTTGCCCTTCACGCCATTGATCAAATAAAT CCTCCACTGAATGTCACAGCAGAGATTGAAGGAACTCGTCTCTCTATCCAATGGGAGAAA CCAGTGTCTGCTTTTCCAATCCATTGCTTTGATTATGAAGTAAAAATACACAATACAAGG AATGGATATTTGCAGATAGAAAAATTGATGACCAATGCATTCATCTCAATAATTGATGAT CTTTCTAAGTACGATGTTCAAGTGAGAGCAGCAGTGAGCTCCATGTGCAGAGAGGCAGGG CTCTGGAGTGAGTGGAGCCAACCTATTTATGTGGGTAAGTAG |
Restriction Sites | Please inquire |
ACCN | NM_175724 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_175724.1, NP_783851.1 |
RefSeq Size | 2024 bp |
RefSeq ORF | 1002 bp |
Locus ID | 3568 |
UniProt ID | Q01344 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway |
Gene Summary | The protein encoded by this gene is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Several alternatively spliced transcript variants encoding four distinct isoforms have been reported. [provided by RefSeq, Jul 2011] Transcript Variant: This variant (2) differs in the 3' end region, which leads to a translation frameshift, when compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222581 | IL5RA (Myc-DDK-tagged)-Human interleukin 5 receptor, alpha (IL5RA), transcript variant 2 |
CN¥ 2,400.00 |
|
RC222581L3 | Lenti-ORF clone of IL5RA (Myc-DDK-tagged)-Human interleukin 5 receptor, alpha (IL5RA), transcript variant 2 |
CN¥ 5,890.00 |
|
RC222581L4 | Lenti-ORF clone of IL5RA (mGFP-tagged)-Human interleukin 5 receptor, alpha (IL5RA), transcript variant 2 |
CN¥ 5,890.00 |
|
RG222581 | IL5RA (tGFP-tagged) - Human interleukin 5 receptor, alpha (IL5RA), transcript variant 2 |
CN¥ 4,370.00 |