RAB3IP (NM_175624) Human Untagged Clone

CAT#: SC307003

RAB3IP (untagged)-Human RAB3A interacting protein (rabin3) (RAB3IP), transcript variant beta 1



  "NM_175624" in other vectors (4)

CNY 6,370.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RAB3IP mouse monoclonal antibody,clone OTI5F2
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RABIN3; RABIN8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307003 representing NM_175624.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTAATGATCCCTTGGAAGGCTTCCATGAAGTAAACCTTGCTTCACCTACTTCTCCGGACCTTCTT
GGTGTGTATGAATCAGGAACTCAAGAGCAGACTACCTCACCAAGTGTCATCTACCGGCCACACCCTTCA
GCTTTATCCTCTGTACCTATCCAGGCAAATGCATTAGATGTTTCTGAACTTCCTACACAACCCGTGTAT
TCATCCCCCAGACGTTTAAATTGTGCGGAAATATCTAGTATCAGCTTTCATGTTACAGACCCAGCCCCT
TGCTCTACCTCTGGAGTCACAGCTGGATTAACTAAATTAACTACAAGAAAGGACAACTATAATGCAGAG
AGAGAGTTTTTACAGGGTGCTACTATAACAGAGGCTTGCGATGGCAGTGATGATATTTTTGGGTTGAGT
ACTGATAGTCTGTCTCGTTTACGAAGCCCATCTGTTTTGGAAGTTAGAGAAAAGGGCTATGAACGATTA
AAAGAAGAACTCGCAAAAGCTCAGAGGGAACTGAAGTTAAAAGATGAAGAATGTGAGAGGCTTTCAAAA
GTGCGAGATCAACTTGGACAGGAATTGGAAGAACTCACAGCTAGTCTATTTGAGGAAGCTCATAAAATG
GTGAGAGAAGCAAATATCAAGCAGGCAACAGCAGAAAAACAGCTAAAAGAAGCACAAGGAAAAATTGAT
GTACTTCAAGCTGAAGTAGCTGCATTGAAGACACTTGTATTGTCCAGTTCTCCAACATCACCTACGCAG
GAGCCTTTGCCAGGTGGAAAGACACCTTTTAAAAAGGGGCATACAAGAAATAAAAGCACAAGCAGTGCT
ATGAGTGGCAGTCATCAGGACCTCAGTGTGATACAGCCAATTGTAAAAGACTGCAAAGAGGCTGACTTA
TCCTTGTATAATGAATTCCGATTGTGGAAGGATGAGCCCACAATGGACAGGACGTGTCCTTTCTTAGAC
AAAATCTACCAGGAAGATATCTTTCCATGTTTAACATTCTCAAAAAGTGAGTTGGCTTCAGCTGTTCTG
GAGGCTGTGGAAAACAATACTCTAAGCATTGAACCAGTGGGATTACAACCTATCCGGTTTGTGAAAGCT
TCTGCAGTTGAATGCGGAGGACCAAAATCACTTCTGTATGTAACTTTTTTACATACATTCGATACATTC
AGCAGGGACTCGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_175624
Insert Size 1188 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_175624.3
RefSeq Size 9417 bp
RefSeq ORF 1188 bp
Locus ID 117177
UniProt ID Q96QF0
MW 43.4 kDa
Gene Summary Guanine nucleotide exchange factor (GEF) which may activate RAB8A and RAB8B. Promotes the exchange of GDP to GTP, converting inactive GDP-bound Rab proteins into their active GTP-bound form. Mediates the release of GDP from RAB8A and RAB8B but not from RAB3A or RAB5. Modulates actin organization and promotes polarized transport of RAB8A-specific vesicles to the cell surface. Together with RAB11A, RAB8A, the exocyst complex, PARD3, PRKCI, ANXA2, CDC42 and DNMBP promotes transcytosis of PODXL to the apical membrane initiation sites (AMIS), apical surface formation and lumenogenesis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (beta 1) has a distinct 5' UTR and multiple coding region differences, compared to variant alpha 2. These differences cause translation initiation at a downstream AUG and a frameshift in the 3' coding region. The resulting isoform (beta 1) is shorter and has a shorter N-terminus and a distinct C-terminus, compared to isoform alpha 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...