ARHGAP27 (NM_174919) Human Untagged Clone

CAT#: SC306956

ARHGAP27 (untagged)-Human Rho GTPase activating protein 27 (ARHGAP27), transcript variant 3



  "NM_174919" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
ARHGAP27 Antibody - middle region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAMGAP1; PP905; SH3D20; SH3P20
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306956 representing NM_174919.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCGGACGTGGTGGGGGACGTGTACGTGCTGGTGGAGCACCCCTTCGAGTACACCGGCAAGGAC
GGGCGCCGCGTGGCCATCCGGCCGAATGAGCGCTACCGGCTGCTGCGGCGCAGCACCGAGCACTGGTGG
CACGTGCGGCGTGAGCCCGGCGGCCGCCCCTTCTACCTGCCTGCGCAGTACGTGCGCGAGCTGCCCGCG
CTGGGCAACCCTGCCGCCGCCGCGCCGCCAGGTCCCCACCCGAGCCCCGCGGCCCCTGAGCCGCTCGCC
TACGACTACCGGTTTGTGAGCGCGGCGGCGACCGCGGGCCCCGACGGCGCCCCCGAGGAGTCCGGAGGC
CGAGCCAGCTCCCTGTGCGGCCCTGCGCAACGCGGCGCCGCGACCCAGCGCAGCAGCCTGGCGCCCGGC
CTGCCAGCCTGCCTGTACCTGCGGCCCGCGGCGCCCGTGCGGCCCGCGCAGTCCCTGAACGACCTGGCC
TGCGCCGCCGTCTCGCCTCCCGCCGGCCTCCTAGGAAGCAGCGGCAGCTTCAAGGCCTGCAGCGTGGCG
GGCTCCTGGGTGTGCCCGCGGCCTCTGGCGCGCAGCGACTCAGAGAACGTCTACGAGGTCATCCAGGAC
TTGCACGTCCCGCCGCCGGAGGAGAGCGCAGAGCAGGTACCTCCCCGGGCGCTGGGGCGCGGAGGCGGG
TGGCGCGCTAGGGACCGCGCCCGCACGGAGCCGGGGCGCAAGGAGACCCGCTCCGCTCAGCGTCGGGCA
CGACGCCCACCTCTGTCCGAAGACTTCGGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_174919
Insert Size 792 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_174919.3
RefSeq Size 1394 bp
RefSeq ORF 792 bp
Locus ID 201176
UniProt ID Q6ZUM4
MW 28.2 kDa
Gene Summary This gene encodes a member of a large family of proteins that activate Rho-type guanosine triphosphate (GTP) metabolizing enzymes. The encoded protein may pay a role in clathrin-mediated endocytosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (3) is a short variant at the 5' end of a much longer ARHGAP27 gene, and differs in the UTRs and CDS compared to variant 4. The encoded isoform (c) is shorter than isoform d. CCDS Note: This CCDS represents a short variant at the 5' end of a much longer ARHGAP27 gene. The protein includes an SH3 domain.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...