IL37 (NM_173202) Human Untagged Clone
CAT#: SC306801
IL37 (untagged)-Human interleukin 1 family, member 7 (zeta) (IL1F7), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FIL1; FIL1(ZETA); FIL1Z; IL-1F7; IL-1H; IL-1H4; IL-1RP1; IL-23; IL-37; IL1F7; IL1H4; IL1RP1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_173202, the custom clone sequence may differ by one or more nucleotides
ATGTCCTTTGTGGGGGAGAACTCAGGAGTGAAAATGGGCTCTGAGGACTGGGAAAAAGAT GAACCCCAGTGCTGCTTAGAAGGTCCAAAGGTGAAGAACTTAAACCCGAAGAAATTCAGC ATTCATGACCAGGATCACAAAGTACTGGTCCTGGACTCTGGGAATCTCATAGCAGTTCCA GATAAAAACTACATACGCCCAGAGATCTTCTTTGCATTAGCCTCATCCTTGAGCTCAGCC TCTGCGGAGAAAGGAAGTCCGATTCTCCTGGGGGTCTCTAAAGGGGAGTTTTGTCTCTAC TGTGACAAGGATAAAGGACAAAGTCATCCATCCCTTCAGCTGAAGAAGGAGAAACTGATG AAGCTGGCTGCCCAAAAGGAATCAGCACGCCGGCCCTTCATCTTTTATAGGGCTCAGGTG GGCTCCTGGAACATGCTGGAGTCGGCGGCTCACCCCGGATGGTTCATCTGCACCTCCTGC AATTGTAATGAGCCTGTTGGGGTGACAGATAAATTTGAGAACAGGAAACACATTGAATTT TCATTTCAACCAGTTTGCAAAGCTGAAATGAGCCCCAGTGAGGTCAGCGATTAG |
Restriction Sites | Please inquire |
ACCN | NM_173202 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_173202.1, NP_775294.1 |
RefSeq Size | 724 bp |
RefSeq ORF | 594 bp |
Locus ID | 27178 |
UniProt ID | Q9NZH6 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine can bind to, and may be a ligand for interleukin 18 receptor (IL18R1/IL-1Rrp). This cytokine also binds to interleukin 18 binding protein (IL18BP), an inhibitory binding protein of interleukin 18 (IL18), and subsequently forms a complex with IL18 receptor beta subunit, and through which it inhibits the activity of IL18. This gene along with eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Five alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an in-frame coding exon, compared to variant 1, resulting an isoform (2) that lacks an internal region, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223678 | IL37 (Myc-DDK-tagged)-Human interleukin 1 family, member 7 (zeta) (IL1F7), transcript variant 2 |
CNY 3,990.00 |
|
RC223678L3 | Lenti-ORF clone of IL37 (Myc-DDK-tagged)-Human interleukin 1 family, member 7 (zeta) (IL1F7), transcript variant 2 |
CNY 5,040.00 |
|
RC223678L4 | Lenti-ORF clone of IL37 (mGFP-tagged)-Human interleukin 1 family, member 7 (zeta) (IL1F7), transcript variant 2 |
CNY 5,890.00 |
|
RG223678 | IL37 (tGFP-tagged) - Human interleukin 1 family, member 7 (zeta) (IL1F7), transcript variant 2 |
CNY 4,240.00 |