United States
Germany
Japan
United Kingdom
China
KChIP2 (KCNIP2) (NM_173197) Human Untagged Clone
CAT＃: SC306798
KCNIP2 (untagged)-Human Kv channel interacting protein 2 (KCNIP2), transcript variant 7
CN¥ 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | KCHIP2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC306798 representing NM_173197.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCGGGGCCAGGGCCGCAAGGAGAGTTTGTCCGATTCCCGAGACCTGGACGGCTCCTACGACCAGCTC ACGGACAGCGTGGACGATGAATTTGAATTGTCCACCGTGTGTCACCGGCCTGAGGGTCTGGAGCAGCTG CAGGAGCAAACCAAATTCACGCGCAAGGAGTTGCAGGTCCTGTACCGGGGCTTCAAGAACGAATGTCCC AGCGGAATTGTCAATGAGGAGAACTTCAAGCAGATTTACTCCCAGTTCTTTCCTCAAGGAGACTCCAGC ACCTATGCCACTTTTCTCTTCAATGCCTTTGACACCAACCATGATGGCTCGGTCAGTTTTGAGGAAATG CTTGACATCATGAAGTCCATCTATGACATGATGGGCAAGTACACGTACCCTGCACTCCGGGAGGAGGCC CCAAGGGAACACGTGGAGAGCTTCTTCCAGAAGATGGACAGAAACAAGGATGGTGTGGTGACCATTGAG GAATTCATTGAGTCTTGTCAAAAGGTACAGCTCCCTGCCCTCTACATTACCCTGACCTGGACTCAGGCC TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_173197 |
| Insert Size | 555 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_173197.2 |
| RefSeq Size | 907 bp |
| RefSeq ORF | 555 bp |
| Locus ID | 30819 |
| UniProt ID | Q9NS61 |
| Protein Families | Druggable Genome, Ion Channels: Other |
| MW | 21.4 kDa |
| Gene Summary | This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belongs to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified from this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (7), also known as KChIP2.5, lacks four coding segments: two consecutive in the 5' region, one in the middle, and one at the 3' end, but has an alternate segment at the 3' end, as compared to variant 1. The alternate segment contains the stop codon. Therefore, isoform 7 has a distinct C-terminus and is shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211485 | KCNIP2 (Myc-DDK-tagged)-Human Kv channel interacting protein 2 (KCNIP2), transcript variant 7 |
CN¥ 2,400.00 |
|
| RC211485L3 | Lenti ORF clone of Human Kv channel interacting protein 2 (KCNIP2), transcript variant 7, Myc-DDK-tagged |
CN¥ 5,890.00 |
|
| RC211485L4 | Lenti ORF clone of Human Kv channel interacting protein 2 (KCNIP2), transcript variant 7, mGFP tagged |
CN¥ 5,890.00 |
|
| RG211485 | KCNIP2 (tGFP-tagged) - Human Kv channel interacting protein 2 (KCNIP2), transcript variant 7 |
CN¥ 4,370.00 |
