IL1F10 (NM_173161) Human Untagged Clone
CAT#: SC306791
IL1F10 (untagged)-Human interleukin 1 family, member 10 (theta) (IL1F10), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FIL1-theta; FKSG75; IL-1HY2; IL-38; IL1-theta; IL1HY2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC306791 representing NM_173161.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGTTCCCTCCCCATGGCAAGATACTACATAATTAAATATGCAGACCAGAAGGCTCTATACACAAGA GATGGCCAGCTGCTGGTGGGAGATCCTGTTGCAGACAACTGCTGTGCAGAGAAGATCTGCATACTTCCT AACAGAGGCTTGGCCCGCACCAAGGTCCCCATTTTCCTGGGGATCCAGGGAGGGAGCCGCTGCCTGGCA TGTGTGGAGACAGAAGAGGGGCCTTCCCTACAGCTGGAGGATGTGAACATTGAGGAACTGTACAAAGGT GGTGAAGAGGCCACACGCTTCACCTTCTTCCAGAGCAGCTCAGGCTCCGCCTTCAGGCTTGAGGCTGCT GCCTGGCCTGGCTGGTTCCTGTGTGGCCCGGCAGAGCCCCAGCAGCCAGTACAGCTCACCAAGGAGAGT GAGCCCTCAGCCCGTACCAAGTTTTACTTTGAACAGAGCTGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_173161 |
Insert Size | 459 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_173161.2 |
RefSeq Size | 1027 bp |
RefSeq ORF | 459 bp |
Locus ID | 84639 |
UniProt ID | Q8WWZ1 |
Protein Families | Druggable Genome, Secreted Protein |
MW | 16.9 kDa |
Gene Summary | The protein encoded by this gene is a member of the interleukin 1 cytokine family. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. This cytokine is thought to participate in a network of interleukin 1 family members to regulate adapted and innate immune responses. Two alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222361 | IL1F10 (Myc-DDK-tagged)-Human interleukin 1 family, member 10 (theta) (IL1F10), transcript variant 2 |
CNY 1,200.00 |
|
RC222361L3 | Lenti ORF clone of Human interleukin 1 family, member 10 (theta) (IL1F10), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222361L4 | Lenti ORF clone of Human interleukin 1 family, member 10 (theta) (IL1F10), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG222361 | IL1F10 (tGFP-tagged) - Human interleukin 1 family, member 10 (theta) (IL1F10), transcript variant 2 |
CNY 4,370.00 |