H1oo (H1FOO) (NM_153833) Human Untagged Clone

CAT#: SC306665

H1FOO (untagged)-Human H1 histone family, member O, oocyte-specific (H1FOO)



  "NM_153833" in other vectors (4)

CNY 3,656.00

CNY 5,610.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


H1-8 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms H1.8; H1FOO; H1oo; osH1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_153833 edited
ATGGCTCCTGGGAGCGTCACCAGCGACATCTCACCCTCCTCGACTTCCACAGCAGGATCA
TCCAGGTCTCCTGAATCTGAAAAGCCAGGCCCGAGCCACGGCGGTGTCCCACCAGGAGGC
CCGAGCCACAGCAGCCTCCCGGTGGGACGCCGCCACCCCCCGGTGCTACGCATGGTGCTG
GAGGCGCTGCAGGCTGGGGAGCAGCGCCGGGGCACGTCGGTGGCAGCTATCAAGCTCTAC
ATCCTGCACAAGTACCCAACAGTGGACGTCCTCCGCTTCAAGTACCTGCTGAAGCAGGCG
CTGGCCACTGGCATGCGCCGTGGCCTCCTCGCCAGGCCCCTCAACTCCAAAGCCAGGGGG
GCCACTGGCAGCTTCAAATTAGTTCCCAAGCACAAGAAGAAAATCCAGCCCAGGAAGATG
GCCCCCGCGACGGCTCCCAGGAGAGCGGGTGAGGCCAAGGGGAAGGGCCCCAAGAAACCA
AGTGAGGCCAAGGAGGACCCTCCCAACGTGGGCAAGGTGAAAAAGGCAGCCAAGAGGCCA
GCAAAGGTGCAGAAGCCTCCTCCCAAGCCAGGCGCAGCCACAGAGAAGGCTCGCAAGCAA
GGCGGCGCGGCCAAGGACACCAGGGCACAGTCGGGAGAGGCTAGGAAGGTGCCCCCCAAG
CCAGACAAGGCCATGCGGGCACCTTCCAGTGCTGGTGGGCTCAGCAGGAAGGCAAAGGCC
AAAGGCAGCAGGAGCAGCCAAGGAGATGCTGAGGCCTACAGGAAAACCAAAGCTGAGAGT
AAGAGTTCAAAACCCACGGCCAGCAAGGTCAAGAATGGTGCTGCTTCCCCGACCAAAAAG
AAGGTGGTGGCCAAGGCCAAGGCCCCTAAAGCTGGGCAGGGGCCAAACACCAAGGCTGCT
GCTCCTGCTAAGGGCAGTGGGTCCAAGGTGGTACCTGCACATTTGTCCAGGAAGACAGAG
GCCCCCAAGGGCCCTAGAAAGGCTGGGCTGCCCATCAAGGCCTCATCATCCAAAGTGTCC
AGCCAGAGGGCTGAAGCTTAG
Restriction Sites Please inquire     
ACCN NM_153833
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_153833.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153833.1, NP_722575.1
RefSeq Size 1067 bp
RefSeq ORF 1041 bp
Locus ID 132243
UniProt ID Q8IZA3
Gene Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. The protein encoded is a replication-independent histone that is a member of the histone H1 family. This gene contains introns, unlike most histone genes. The related mouse gene is expressed only in oocytes. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...