United States
Germany
Japan
United Kingdom
China
H1oo (H1FOO) (NM_153833) Human Untagged Clone
CAT＃: SC306665
H1FOO (untagged)-Human H1 histone family, member O, oocyte-specific (H1FOO)
CNY 3,656.00
CNY 5,610.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | H1.8; H1FOO; H1oo; osH1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_153833 edited
ATGGCTCCTGGGAGCGTCACCAGCGACATCTCACCCTCCTCGACTTCCACAGCAGGATCA TCCAGGTCTCCTGAATCTGAAAAGCCAGGCCCGAGCCACGGCGGTGTCCCACCAGGAGGC CCGAGCCACAGCAGCCTCCCGGTGGGACGCCGCCACCCCCCGGTGCTACGCATGGTGCTG GAGGCGCTGCAGGCTGGGGAGCAGCGCCGGGGCACGTCGGTGGCAGCTATCAAGCTCTAC ATCCTGCACAAGTACCCAACAGTGGACGTCCTCCGCTTCAAGTACCTGCTGAAGCAGGCG CTGGCCACTGGCATGCGCCGTGGCCTCCTCGCCAGGCCCCTCAACTCCAAAGCCAGGGGG GCCACTGGCAGCTTCAAATTAGTTCCCAAGCACAAGAAGAAAATCCAGCCCAGGAAGATG GCCCCCGCGACGGCTCCCAGGAGAGCGGGTGAGGCCAAGGGGAAGGGCCCCAAGAAACCA AGTGAGGCCAAGGAGGACCCTCCCAACGTGGGCAAGGTGAAAAAGGCAGCCAAGAGGCCA GCAAAGGTGCAGAAGCCTCCTCCCAAGCCAGGCGCAGCCACAGAGAAGGCTCGCAAGCAA GGCGGCGCGGCCAAGGACACCAGGGCACAGTCGGGAGAGGCTAGGAAGGTGCCCCCCAAG CCAGACAAGGCCATGCGGGCACCTTCCAGTGCTGGTGGGCTCAGCAGGAAGGCAAAGGCC AAAGGCAGCAGGAGCAGCCAAGGAGATGCTGAGGCCTACAGGAAAACCAAAGCTGAGAGT AAGAGTTCAAAACCCACGGCCAGCAAGGTCAAGAATGGTGCTGCTTCCCCGACCAAAAAG AAGGTGGTGGCCAAGGCCAAGGCCCCTAAAGCTGGGCAGGGGCCAAACACCAAGGCTGCT GCTCCTGCTAAGGGCAGTGGGTCCAAGGTGGTACCTGCACATTTGTCCAGGAAGACAGAG GCCCCCAAGGGCCCTAGAAAGGCTGGGCTGCCCATCAAGGCCTCATCATCCAAAGTGTCC AGCCAGAGGGCTGAAGCTTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_153833 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_153833.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_153833.1, NP_722575.1 |
| RefSeq Size | 1067 bp |
| RefSeq ORF | 1041 bp |
| Locus ID | 132243 |
| UniProt ID | Q8IZA3 |
| Gene Summary | Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. The protein encoded is a replication-independent histone that is a member of the histone H1 family. This gene contains introns, unlike most histone genes. The related mouse gene is expressed only in oocytes. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215554 | H1FOO (Myc-DDK-tagged)-Human H1 histone family, member O, oocyte-specific (H1FOO) |
CNY 3,656.00 |
|
| RC215554L3 | Lenti ORF clone of Human H1 histone family, member O, oocyte-specific (H1FOO), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC215554L4 | Lenti ORF clone of Human H1 histone family, member O, oocyte-specific (H1FOO), mGFP tagged |
CNY 5,890.00 |
|
| RG215554 | H1FOO (tGFP-tagged) - Human H1 histone family, member O, oocyte-specific (H1FOO) |
CNY 4,370.00 |
