United States
Germany
Japan
United Kingdom
China
DEFB119 (NM_153289) Human Untagged Clone
CAT＃: SC306581
DEFB119 (untagged)-Human defensin, beta 119 (DEFB119), transcript variant 1
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DEFB-19; DEFB-20; DEFB20; DEFB120; ESC42-RELA; ESC42-RELB |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC306581 representing NM_153289.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAACTTCTTTACCTGTTTCTTGCCATCCTTCTGGCCATAGAAGAACCAGTGATATCAGGCAAACGC CACATCCTTCGATGCATGGGTAACAGTGGAATTTGTAGGGCCTCTTGCAAAAAGAACGAACAGCCCTAC CTCTATTGCAGAAATTGTCAGTCCTGCTGCCTCCAGTCCTACATGAGGATAAGCATTTCTGGCAAAGAG GAAAATACCGACTGGTCTTATGAGAAGCAGTGGCCAAGACTACCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_153289 |
| Insert Size | 255 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_153289.3 |
| RefSeq Size | 515 bp |
| RefSeq ORF | 255 bp |
| Locus ID | 245932 |
| UniProt ID | Q8N690 |
| Protein Families | Secreted Protein |
| MW | 9.8 kDa |
| Gene Summary | This gene encodes a member of the beta subfamily of defensins. Beta-defensins are antimicrobial peptides that protect tissues and organs from infection by a variety of microorganisms. This gene is found in a cluster with other beta-defensin genes on the long arm of chromosome 20. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (1) contains an alternate 3' exon, compared to variant 3 resulting in a different 3' coding region and 3' UTR. The encoded isoform (a) is shorter and has a distinct C-terminus, compared to isoform c. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209341 | DEFB119 (Myc-DDK-tagged)-Human defensin, beta 119 (DEFB119), transcript variant 1 |
CNY 1,200.00 |
|
| RC209341L3 | Lenti ORF clone of Human defensin, beta 119 (DEFB119), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC209341L4 | Lenti ORF clone of Human defensin, beta 119 (DEFB119), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG209341 | DEFB119 (tGFP-tagged) - Human defensin, beta 119 (DEFB119), transcript variant 1 |
CNY 2,800.00 |
其它DEFB119产品
