CALHM4 (NM_153036) Human Untagged Clone

CAT#: SC306545

FAM26D (untagged)-Human family with sequence similarity 26, member D (FAM26D)



  "NM_153036" in other vectors (6)

CN¥ 1,200.00

CN¥ 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C6orf78; FAM26D
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_153036 edited
GCCACCATGCTGGGTTGGATTTTGATCACCTTGGCAACCATTGCTGCCTTAGTCTCCTGC
TGTGTGGCAAAGTGCTGCTCTCCCCTCACCTCTCTGCAACATTGCTACTGGACCAGCCAC
CTCCAGAATGAGAGAGAACTCTTTGAACAAGCAGCAGAGCAGCACTCTCGGCTCCTCATG
ATGCATCGCATAAAGAAGCTATTTGGCTTCATTCCCGGGAGTGAAGACGTCAAACACATC
CGCATTCCTTCTTGTCAGGACTGGAAAGATATTTCAGTACCCACTCTTTTATGCATGGGT
GATGACTTGCAAGGTCACTATAGCTTCCTTGGAAATAGGGTGGATGAGGATAATGAGGAA
GACAGATCAAGAGGTATTGAATTAAAACCTTGA
Restriction Sites Please inquire     
ACCN NM_153036
Insert Size 400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_153036.1, NP_694581.1
RefSeq Size 1699 bp
RefSeq ORF 387 bp
Locus ID 221301
UniProt ID Q5JW98
Protein Families Transmembrane
Gene Summary Pore-forming subunit of a voltage-gated ion channel.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks a portion of the 5' coding region and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Both variants 3 and 4 encode isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...