Kallikrein 10 (KLK10) (NM_145888) Human Untagged Clone

CAT#: SC306286

KLK10 (untagged)-Human kallikrein-related peptidase 10 (KLK10), transcript variant 2



  "NM_145888" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal Anti-KLK10 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NES1; PRSSL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306286 representing NM_145888.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGAGCTCCGCACCTCCACCTCTCCGCCGCCTCTGGCGCCCGGGCTCTGGCGAAGCTGCTGCCGCTG
CTGATGGCGCAACTCTGGGCCGCAGAGGCGGCGCTGCTCCCCCAAAACGACACGCGCTTGGACCCCGAA
GCCTATGGCTCCCCGTGCGCGCGCGGCTCGCAGCCCTGGCAGGTCTCGCTCTTCAACGGCCTCTCGTTC
CACTGCGCGGGTGTCCTGGTGGACCAGAGTTGGGTGCTGACGGCCGCGCACTGCGGAAACAAGCCACTG
TGGGCTCGAGTAGGGGATGACCACCTGCTGCTTCTTCAGGGAGAGCAGCTCCGCCGGACCACTCGCTCT
GTTGTCCATCCCAAGTACCACCAGGGCTCAGGCCCCATCCTGCCAAGGCGAACGGATGAGCACGATCTC
ATGTTGCTGAAGCTGGCCAGGCCCGTAGTGCTGGGGCCCCGCGTCCGGGCCCTGCAGCTTCCCTACCGC
TGTGCTCAGCCCGGAGACCAGTGCCAGGTTGCTGGCTGGGGCACCACGGCCGCCCGGAGAGTGAAGTAC
AACAAGGGCCTGACCTGCTCCAGCATCACTATCCTGAGCCCTAAAGAGTGTGAGGTCTTCTACCCTGGC
GTGGTCACCAACAACATGATATGTGCTGGACTGGACCGGGGCCAGGACCCTTGCCAGAGTGACTCTGGA
GGCCCCCTGGTCTGTGACGAGACCCTCCAAGGCATCCTCTCGTGGGGTGTTTACCCCTGTGGCTCTGCC
CAGCATCCAGCTGTCTACACCCAGATCTGCAAATACATGTCCTGGATCAATAAAGTCATACGCTCCAAC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_145888
Insert Size 831 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_145888.2
RefSeq Size 2985 bp
RefSeq ORF 831 bp
Locus ID 5655
UniProt ID O43240
Protein Families Druggable Genome, Protease, Secreted Protein
MW 30.2 kDa
Gene Summary Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its encoded protein is secreted and may play a role in suppression of tumorigenesis in breast and prostate cancers. Alternate splicing of this gene results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All transcript variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...