HTRA2 (NM_145074) Human Untagged Clone

CAT#: SC306217

HTRA2 (untagged)-Human HtrA serine peptidase 2 (HTRA2), nuclear gene encoding mitochondrial protein, transcript variant 2



  "NM_145074" in other vectors (6)

CNY 5,800.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal OMI Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MGCA8; OMI; PARK13; PRSS25
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306217 representing NM_145074.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGCGCCGAGGGCGGGGCGGGGTGCAGGCTGGAGCCTTCGGGCATGGCGGGCTTTGGGGGGCATT
CGCTGGGGGAGGAGACCCCGTTTGACCCCTGACCTCCGGGCCCTGCTGACGTCAGGAACTTCTGACCCC
CGGGCCCGAGTGACTTATGGGACCCCCAGTCTCTGGGCCCGGTTGTCTGTTGGGGTCACTGAACCCCGA
GCATGCCTGACGTCTGGGACCCCGGGTCCCCGGGCACAACTGACTGCGGTGACCCCAGATACCAGGACC
CGGGAGGCCTCAGAGAACTCTGGAACCCGTTCGCGCGCGTGGCTGGCGGTGGCGCTGGGCGCTGGGGGG
GCAGTGCTGTTGTTGTTGTGGGGCGGGGGTCGGGGTCCTCCGGCCGTCCTCGCCGCCGTCCCTAGCCCG
CCGCCCGCTTCTCCCCGGAGTCAGTACAACTTCATCGCAGATGTGGTGGAGAAGACAGCACCTGCCGTG
GTCTATATCGAGATCCTGGACCGGCACCCTTTCTTGGGCCGCGAGGTCCCTATCTCGAACGGCTCAGGA
TTCGTGGTGGCTGCCGATGGGCTCATTGTCACCAACGCCCATGTGGTGGCTGATCGGCGCAGAGTCCGT
GTGAGACTGCTAAGCGGCGACACGTATGAGGCCGTGGTCACAGCTGTGGATCCCGTGGCAGACATCGCA
ACGCTGAGGATTCAGACTAAGTTTGGAAACTCTGGAGGTCCCCTGGTTAACCTGGATGGGGAGGTGATT
GGAGTGAACACCATGAAGGTCACAGCTGGAATCTCCTTTGCCATCCCTTCTGATCGTCTTCGAGAGTTT
CTGCATCGTGGGGAAAAGAAGAATTCCTCCTCCGGAATCAGTGGGTCCCAGCGGCGCTACATTGGGGTG
ATGATGCTGACCCTGAGTCCCAGGGCTGGTCTGCGGCCTGGTGATGTGATTTTGGCCATTGGGGAGCAG
ATGGTACAAAATGCTGAAGATGTTTATGAAGCTGTTCGAACCCAATCCCAGTTGGCAGTGCAGATCCGG
CGGGGACGAGAAACACTGACCTTATATGTGACCCCTGAGGTCACAGAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_145074
Insert Size 1086 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_145074.2
RefSeq Size 2259 bp
RefSeq ORF 1086 bp
Locus ID 27429
UniProt ID O43464
Domains PDZ
Protein Families Druggable Genome, Protease, Transmembrane
Protein Pathways Parkinson's disease
MW 38.5 kDa
Gene Summary This gene encodes a serine protease. The protein has been localized in the endoplasmic reticulum and interacts with an alternatively spliced form of mitogen-activated protein kinase 14. The protein has also been localized to the mitochondria with release to the cytosol following apoptotic stimulus. The protein is thought to induce apoptosis by binding the apoptosis inhibitory protein baculoviral IAP repeat-containing 4. Nuclear localization of this protein has also been observed. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (2) lacks two in-frame exons in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1 and has a modified PDZ domain. Isoform 2 has no detectable protease activity.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...