NETO1 (NM_138999) Human Untagged Clone
CAT#: SC306098
NETO1 (untagged)-Human neuropilin (NRP) and tolloid (TLL)-like 1 (NETO1), transcript variant 1
CNY 1,320.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BCTL1; BTCL1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_138999, the custom clone sequence may differ by one or more nucleotides
ATGCTGGCAGAGCCATTCCCTAAGGTTGTAGCAAGTTTAATCATCCTCCATTTGTCTGGG GCAACCAAGAAAGGAACAGAAAAGCAAACCACCTCAGAAACACAGAAGTCAGTGCAGTGT GGAACTTGGACAAAACATGCAGAGGGAGGTATCTTTACCTCTCCCAACTATCCCAGCAAG TATCCCCCTGACCGGGAATGCATCTACATCATAGAAGCCGCTCCAAGACAGTGCATTGAA CTTTACTTTGATGAAAAGTACTCTATTGAACCGTCTTGGGAGTGCAAATTTGATCATATT GAAGTTCGAGATGGACCTTTTGGCTTTTCTCCAATAATTGGACGTTTCTGTGGACAACAA AATCCACCTGTCATAAAATCCAGTGGAAGATTTCTATGGATTAAATTTTTTGCTGATGGA GAGCTGGAATCTATGGGATTTTCAGCTCGATACAATTTCACACCTGAATAA |
Restriction Sites | Please inquire |
ACCN | NM_138999 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_138999.1, NP_620552.1 |
RefSeq Size | 1849 bp |
RefSeq ORF | 471 bp |
Locus ID | 81832 |
UniProt ID | Q8TDF5 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. This protein is thought to play a critical role in spatial learning and memory by regulating the function of synaptic N-methyl-D-aspartic acid receptor complexes in the hippocampus. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2017] Transcript Variant: This variant (1), also known as sNETO1, encodes isoform 1 and was described by Stohr et. al (PMID:11943477). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217464 | NETO1 (Myc-DDK-tagged)-Human neuropilin (NRP) and tolloid (TLL)-like 1 (NETO1), transcript variant 1 |
CNY 1,800.00 |
|
RC217464L3 | Lenti-ORF clone of NETO1 (Myc-DDK-tagged)-Human neuropilin (NRP) and tolloid (TLL)-like 1 (NETO1), transcript variant 1 |
CNY 5,890.00 |
|
RC217464L4 | Lenti-ORF clone of NETO1 (mGFP-tagged)-Human neuropilin (NRP) and tolloid (TLL)-like 1 (NETO1), transcript variant 1 |
CNY 5,890.00 |
|
RG217464 | NETO1 (tGFP-tagged) - Human neuropilin (NRP) and tolloid (TLL)-like 1 (NETO1), transcript variant 1 |
CNY 3,400.00 |