United States
Germany
Japan
United Kingdom
China
MADCAM1 (NM_130760) Human Untagged Clone
CAT＃: SC305894
MADCAM1 (untagged)-Human mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1
CNY 3,656.00
CNY 6,180.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MACAM1 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_130760, the custom clone sequence may differ by one or more nucleotides
ATGGATTTCGGACTGGCCCTCCTGCTGGCGGGGCTTCTGGGGCTCCTCCTCGGCCAGTCCCTCCAGGTGA AGCCCCTGCAGGTGGAGCCCCCGGAGCCGGTGGTGGCCGTGGCCTTGGGCGCCTCGCGCCAGCTCACCTG CCGCCTGGCCTGCGCGGACCGCGGGGCCTCGGTGCAGTGGCGGGGCCTGGACACCAGCCTGGGCGCGGTG CAGTCGGACACGGGCCGCAGCGTCCTCACCGTGCGCAACGCCTCGCTGTCGGCGGCCGGGACCCGCGTGT GCGTGGGCTCCTGCGGGGGCCGCACCTTCCAGCACACCGTGCAGCTCCTTGTGTACGCCTTCCCGGACCA GCTGACCGTCTCCCCAGCAGCCCTGGTGCCTGGTGACCCGGAGGTGGCCTGTACGGCCCACAAAGTCACG CCCGTGGACCCCAACGCGCTCTCCTTCTCCCTGCTCGTCGGGGGCCAGGAACTGGAGGGGGCGCAAGCCC TGGGCCCGGAGGTGCAGGAGGAGGAGGAGGAGCCCCAGGGGGACGAGGACGTGCTGTTCAGGGTGACAGA GCGCTGGCGGCTGCCGCCCCTGGGGACCCCTGTCCCGCCCGCCCTCTACTGCCAGGCCACGATGAGGCTG CCTGGCTTGGAGCTCAGCCACCGCCAGGCCATCCCCGTCCTGCACAGCCCGACCTCCCCGGAGCCTCCCG ACACCACCTCCCCGGAGTCTCCCGACACCACCTCCCCGGAGTCTCCCGACACCACCTCCCAGGAGCCTCC CGACACCACCTCCCCGGAGCCTCCCGACAAGACCTCCCCGGAGCCCGCCCCCCAGCAGGGCTCCACACAC ACCCCCAGGAGCCCAGGCTCCACCAGGACTCGCCGCCCTGAGATCTCCCAGGCTGGGCCCACGCAGGGAG AAGTGATCCCAACAGGCTCGTCCAAACCTGCGGGTGACCAGCTGCCCGCGGCTCTGTGGACCAGCAGTGC GGTGCTGGGACTGCTGCTCCTGGCCTTGCCCACCTATCACCTCTGGAAACGCTGCCGGCACCTGGCTGAG GACGACACCCACCCACCAGCTTCTCTGAGGCTTCTGCCCCAGGTGTCGGCCTGGGCTGGGTTAAGGGGGA CCGGCCAGGTCGGGATCAGCCCCTCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_130760 |
| Insert Size | 1500 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_130760.2, NP_570116.2 |
| RefSeq Size | 1546 bp |
| RefSeq ORF | 1149 bp |
| Locus ID | 8174 |
| UniProt ID | Q13477 |
| Protein Pathways | Cell adhesion molecules (CAMs) |
| Gene Summary | The protein encoded by this gene is an endothelial cell adhesion molecule that interacts preferentially with the leukocyte beta7 integrin LPAM-1 (alpha4beta7), L-selectin, and VLA-4 (alpha4beta1) on myeloid cells to direct leukocytes into mucosal and inflamed tissues. It is a member of the immunoglobulin family and is similar to ICAM1 and VCAM1. At least seven alternatively spliced transcripts encoding different protein isoforms have been found for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) is the longer, predominant transcript and encodes the longer isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219060 | MADCAM1 (Myc-DDK-tagged)-Human mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1 |
CNY 3,656.00 |
|
| RC219060L1 | Lenti ORF clone of Human mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
| RC219060L2 | Lenti ORF clone of Human mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC219060L3 | Lenti ORF clone of Human mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC219060L4 | Lenti ORF clone of Human mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG219060 | MADCAM1 (tGFP-tagged) - Human mucosal vascular addressin cell adhesion molecule 1 (MADCAM1), transcript variant 1 |
CNY 5,256.00 |
其它MADCAM1产品
