United States
Germany
Japan
United Kingdom
China
WFDC3 (NM_080614) Human Untagged Clone
CAT＃: SC305804
WFDC3 (untagged)-Human WAP four-disulfide core domain 3 (WFDC3)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | dJ447F3.3; WAP14 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_080614 edited
ATCATGATGTTAAGCTGCCTCTTTCTTCTGAAGGCACTTCTTGCTCTTGGGTCTCTGGAA TCCTGGATAACTGCAGGAGAACATGCAAAAGAGGGAGAATGCCCTCCCGATAAGAACCCA TGCAAAGAGCTGTGCCAGGGTGATGAATTGTGTCCGGCTGAACAGAAGTGCTGCACCACA GGCTGTGGTCGGATCTGCCGAGACATTCCTAAGGGGAGGAAAAGAGATTGCCCTAGGGTT ATTCGGAAACAATCCTGTTTGAAAAGGTGCATCACTGATAAGACATGTCCAGGTGTAAAG AAATGCTGCACGCTTGGCTGCAACAAGAGCTGTGTAGTCCCAATCTCTAAACAGAAGCTG GCAGAGTTTGGTGGTGAATGTCCCGCTGACCCCCTTCCGTGTGAGGAGCTGTGTGATGGG GATGCATCCTGTCCCCAGGGGCATAAATGCTGCAGCACCGGCTGTGGCCGCACCTGCCTC GGAGACATTGAGGGAGGGCGGGGCGGTGATTGTCCAAAAGTTCTGGTGGGCCTGTGCATT GTTGGCTGTGTGATGGATGAGAATTGTCAAGCTGGAGAAAAATGTTGCAAGTCAGGCTGT GGCCGCTTCTGTGTCCCACCAGTCCTGCCCCCAAAACTGACCATGAACCCCAACTGGACT GTGAGGTCTGATTCCGAATTAGAGATCCCGGTGCCCTAGCTGTGCTGATTTGTCT |
| Restriction Sites | Please inquire |
| ACCN | NM_080614 |
| Insert Size | 700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to contain 2 SNPs compared with NM_080614.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_080614.1, NP_542181.1 |
| RefSeq Size | 1000 bp |
| RefSeq ORF | 696 bp |
| Locus ID | 140686 |
| UniProt ID | Q8IUB2 |
| Protein Families | Secreted Protein |
| Gene Summary | This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. The encoded protein contains four WFDC domains. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Alternatively spliced transcript variants have been observed but their full-length nature has not been determined. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222831 | WFDC3 (Myc-DDK-tagged)-Human WAP four-disulfide core domain 3 (WFDC3) |
CNY 2,400.00 |
|
| RC222831L3 | Lenti ORF clone of Human WAP four-disulfide core domain 3 (WFDC3), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC222831L4 | Lenti ORF clone of Human WAP four-disulfide core domain 3 (WFDC3), mGFP tagged |
CNY 5,890.00 |
|
| RG222831 | WFDC3 (tGFP-tagged) - Human WAP four-disulfide core domain 3 (WFDC3) |
CNY 4,000.00 |
