Artemin (ARTN) (NM_057091) Human Untagged Clone
CAT#: SC305737
ARTN (untagged)-Human artemin (ARTN), transcript variant 2
CN¥ 3,990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ART; ENOVIN; EVN; NBN |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_057091, the custom clone sequence may differ by one or more nucleotides
ATGGAACTTGGACTTGGAGGCCTCTCCACGCTGTCCCACTGCCCCTGGCCTAGGCAGCAG CCTGCCCTGTGGCCCACCCTGGCCGCTCTGGCTCTGCTGAGCAGCGTCGCAGAGGCCTCC CTGGGCTCCGCGCCCCGCAGCCCTGCCCCCCGCGAAGGCCCCCCGCCTGTCCTGGCGTCC CCCGCCGGCCACCTGCCGGGGGGACGCACGGCCCGCTGGTGCAGTGGAAGAGCCCGGCGG CCGCCGCCGCAGCCTTCTCGGCCCGCGCCCCCGCCGCCTGCACCCCCATCTGCTCTTCCC CGCGGGGGCCGCGCGGCGCGGGCTGGGGGCCCGGGCAGCCGCGCTCGGGCAGCGGGGGCG CGGGGCTGCCGCCTGCGCTCGCAGCTGGTGCCGGTGCGCGCGCTCGGCCTGGGCCACCGC TCCGACGAGCTGGTGCGTTTCCGCTTCTGCAGCGGCTCCTGCCGCCGCGCGCGCTCTCCA CACGACCTCAGCCTGGCCAGCCTACTGGGCGCCGGGGCCCTGCGACCGCCCCCGGGCTCC CGGCCCGTCAGCCAGCCCTGCTGCCGACCCACGCGCTACGAAGCGGTCTCCTTCATGGAC GTCAACAGCACCTGGAGAACCGTGGACCGCCTCTCCGCCACCGCCTGCGGCTGCCTGGGC TGA |
Restriction Sites | Please inquire |
ACCN | NM_057091 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_057091.1, NP_476432.1 |
RefSeq Size | 1892 bp |
RefSeq ORF | 663 bp |
Locus ID | 9048 |
UniProt ID | Q5T4W7 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | This gene encodes a secreted ligand of the glial cell line-derived neurotrophic factor (GDNF) subfamily and TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein signals through the RET receptor and GFR alpha 3 coreceptor, and supports the survival of a number of peripheral neuron populations and at least one population of dopaminergic CNS neurons. This protein has also been shown to promote tumor growth, metastasis, and drug resistance in mammary carcinoma. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (2) encodes the shorter isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215471 | ARTN (Myc-DDK-tagged)-Human artemin (ARTN), transcript variant 2 |
CN¥ 2,400.00 |
|
RC215471L1 | Lenti-ORF clone of ARTN (Myc-DDK-tagged)-Human artemin (ARTN), transcript variant 2 |
CN¥ 4,800.00 |
|
RC215471L2 | Lenti-ORF clone of ARTN (mGFP-tagged)-Human artemin (ARTN), transcript variant 2 |
CN¥ 5,890.00 |
|
RC215471L3 | Lenti-ORF clone of ARTN (Myc-DDK-tagged)-Human artemin (ARTN), transcript variant 2 |
CN¥ 5,890.00 |
|
RC215471L4 | Lenti-ORF clone of ARTN (mGFP-tagged)-Human artemin (ARTN), transcript variant 2 |
CN¥ 5,890.00 |
|
RG215471 | ARTN (tGFP-tagged) - Human artemin (ARTN), transcript variant 2 |
CN¥ 4,370.00 |
其它Artemin产品