MFI2 (MELTF) (NM_033316) Human Untagged Clone

CAT#: SC305611

MFI2 (untagged)-Human antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 (MFI2), transcript variant 2



  "NM_033316" in other vectors (4)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-MFI2 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD228; MAP97; MFI2; MTf; MTF1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_033316 edited
GCCACCATGCGGGGTCCGAGCGGGGCTCTGTGGCTGCTCCTGGCTCTGCGCACCGTGCTC
GGTGGCATGGAGGTGCGGTGGTGCGCCACCTCGGACCCAGAGCAGCACAAGTGCGGCAAC
ATGAGCGAGGCCTTCCGGGAAGCGGGCATCCAGCCCTCCCTCCTCTGCGTCCGGGGCACC
TCCGCCGACCACTGCGTCCAGCTCATCGCGGCCCAGGAGGCTGACGCCATCACTCTGGAT
GGAGGAGCCATCTATGAGGCGGGAAAGGAGCACGGCCTGAAGCCGGTGGTGGGCGAAGTG
TACGATCAAGAGGTCGGTACCTCCTATTACGCCGTGGCTGTGGTCAGGAGGAGCTCCCAT
GTGACCATTGACACCCTGAAAGGCGTGAAGTCCTGCCACACGGGCATCAATCGCACAGTG
GGCTGGAACGTGCCCGTGGGCTACCTGGTGGAGAGCGGCCGCCTCTCGGTGATGGGCTGC
GATGTACTCAAAGCTGTCAGCGACTATTTTGGGGGCAGCTGCGTCCCGGGGGCAGGAGAG
ACCAGTTACTCTGAGTCCCTCTGTCGCCTCTGCAGGGGTGACAGCTCTGGGGAAGGGGTG
TGTGACAAGAGCCCCCTGGAGAGATACTACGACTACAGCGGGGCCTTCCGGTGCCTGGCG
GAAGGGGCAGGGGACGTGGCTTTTGTGAAGCACAGCACGGTACTGGAGAACACGGATGAA
AGTCCATCACGAAGGCAAACATGGACCAGATCTGAGGAGGAAGAAGGCGAGTGCCCTGCA
CACGAGGAAGCACGTAGGACGATGCGCTCTAGTGCTGGGCAAGCCTGGAAATGGGCTCCC
GTTCACAGGCCCCAGGACGAGTCTGACAAAGGAGAATTTGGAAAACGGGCAAAGAGTAGG
GATATGTTGGGTTAA
Restriction Sites Please inquire     
ACCN NM_033316
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_033316.2, NP_201573.1
RefSeq Size 1651 bp
RefSeq ORF 909 bp
Locus ID 4241
UniProt ID P08582
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs from variant 1 in the central coding region, resulting in a frameshift. The encoded isoform (2) has a truncated and distinct C-terminus and lacks the propeptide compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...