United States
Germany
Japan
United Kingdom
China
MFI2 (MELTF) (NM_033316) Human Untagged Clone
CAT＃: SC305611
MFI2 (untagged)-Human antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 (MFI2), transcript variant 2
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CD228; MAP97; MFI2; MTf; MTF1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_033316 edited
GCCACCATGCGGGGTCCGAGCGGGGCTCTGTGGCTGCTCCTGGCTCTGCGCACCGTGCTC GGTGGCATGGAGGTGCGGTGGTGCGCCACCTCGGACCCAGAGCAGCACAAGTGCGGCAAC ATGAGCGAGGCCTTCCGGGAAGCGGGCATCCAGCCCTCCCTCCTCTGCGTCCGGGGCACC TCCGCCGACCACTGCGTCCAGCTCATCGCGGCCCAGGAGGCTGACGCCATCACTCTGGAT GGAGGAGCCATCTATGAGGCGGGAAAGGAGCACGGCCTGAAGCCGGTGGTGGGCGAAGTG TACGATCAAGAGGTCGGTACCTCCTATTACGCCGTGGCTGTGGTCAGGAGGAGCTCCCAT GTGACCATTGACACCCTGAAAGGCGTGAAGTCCTGCCACACGGGCATCAATCGCACAGTG GGCTGGAACGTGCCCGTGGGCTACCTGGTGGAGAGCGGCCGCCTCTCGGTGATGGGCTGC GATGTACTCAAAGCTGTCAGCGACTATTTTGGGGGCAGCTGCGTCCCGGGGGCAGGAGAG ACCAGTTACTCTGAGTCCCTCTGTCGCCTCTGCAGGGGTGACAGCTCTGGGGAAGGGGTG TGTGACAAGAGCCCCCTGGAGAGATACTACGACTACAGCGGGGCCTTCCGGTGCCTGGCG GAAGGGGCAGGGGACGTGGCTTTTGTGAAGCACAGCACGGTACTGGAGAACACGGATGAA AGTCCATCACGAAGGCAAACATGGACCAGATCTGAGGAGGAAGAAGGCGAGTGCCCTGCA CACGAGGAAGCACGTAGGACGATGCGCTCTAGTGCTGGGCAAGCCTGGAAATGGGCTCCC GTTCACAGGCCCCAGGACGAGTCTGACAAAGGAGAATTTGGAAAACGGGCAAAGAGTAGG GATATGTTGGGTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_033316 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_033316.2, NP_201573.1 |
| RefSeq Size | 1651 bp |
| RefSeq ORF | 909 bp |
| Locus ID | 4241 |
| UniProt ID | P08582 |
| Protein Families | Druggable Genome |
| Gene Summary | The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs from variant 1 in the central coding region, resulting in a frameshift. The encoded isoform (2) has a truncated and distinct C-terminus and lacks the propeptide compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224660 | MFI2 (Myc-DDK-tagged)-Human antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 (MFI2), transcript variant 2 |
CNY 2,400.00 |
|
| RC224660L3 | Lenti ORF clone of Human antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 (MFI2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC224660L4 | Lenti ORF clone of Human antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 (MFI2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG224660 | MFI2 (tGFP-tagged) - Human antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 (MFI2), transcript variant 2 |
CNY 4,370.00 |
