CAMK2N2 (NM_033259) Human Untagged Clone

CAT#: SC305603

CAMK2N2 (untagged)-Human calcium/calmodulin-dependent protein kinase II inhibitor 2 (CAMK2N2)



  "NM_033259" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAM-KIIN; CAMKIIN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305603 representing NM_033259.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCGAGATCCTGCCCTACAGCGAAGACAAGATGGGCCGCTTCGGCGCAGACCCCGAGGGCTCCGAC
CTCTCCTTCAGCTGCCGCCTGCAGGACACCAACTCCTTCTTCGCGGGCAACCAGGCCAAGCGACCCCCC
AAGCTGGGCCAGATCGGCCGAGCCAAGCGAGTGGTGATCGAGGATGACCGGATAGACGACGTGCTGAAG
GGGATGGGGGAGAAGCCGCCGTCCGGAGTGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_033259
Insert Size 240 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_033259.2
RefSeq Size 1360 bp
RefSeq ORF 240 bp
Locus ID 94032
UniProt ID Q96S95
MW 8.7 kDa
Gene Summary This gene encodes a protein that is highly similar to the rat CaM-KII inhibitory protein, an inhibitor of calcium/calmodulin-dependent protein kinase II (CAMKII). CAMKII regulates numerous physiological functions, including neuronal synaptic plasticity through the phosphorylation of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-type glutamate (AMPA) receptors. Studies of the similar protein in rat suggest that this protein may function as a negative regulator of CaM-KII and may act to inhibit the phosphorylation of AMPA receptors. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...