CAMK2N2 (NM_033259) Human Untagged Clone
CAT#: SC305603
CAMK2N2 (untagged)-Human calcium/calmodulin-dependent protein kinase II inhibitor 2 (CAMK2N2)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CAM-KIIN; CAMKIIN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305603 representing NM_033259.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCGAGATCCTGCCCTACAGCGAAGACAAGATGGGCCGCTTCGGCGCAGACCCCGAGGGCTCCGAC CTCTCCTTCAGCTGCCGCCTGCAGGACACCAACTCCTTCTTCGCGGGCAACCAGGCCAAGCGACCCCCC AAGCTGGGCCAGATCGGCCGAGCCAAGCGAGTGGTGATCGAGGATGACCGGATAGACGACGTGCTGAAG GGGATGGGGGAGAAGCCGCCGTCCGGAGTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_033259 |
Insert Size | 240 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_033259.2 |
RefSeq Size | 1360 bp |
RefSeq ORF | 240 bp |
Locus ID | 94032 |
UniProt ID | Q96S95 |
MW | 8.7 kDa |
Gene Summary | This gene encodes a protein that is highly similar to the rat CaM-KII inhibitory protein, an inhibitor of calcium/calmodulin-dependent protein kinase II (CAMKII). CAMKII regulates numerous physiological functions, including neuronal synaptic plasticity through the phosphorylation of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-type glutamate (AMPA) receptors. Studies of the similar protein in rat suggest that this protein may function as a negative regulator of CaM-KII and may act to inhibit the phosphorylation of AMPA receptors. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211256 | CAMK2N2 (Myc-DDK-tagged)-Human calcium/calmodulin-dependent protein kinase II inhibitor 2 (CAMK2N2) |
CNY 1,200.00 |
|
RC211256L3 | Lenti ORF clone of Human calcium/calmodulin-dependent protein kinase II inhibitor 2 (CAMK2N2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC211256L4 | Lenti ORF clone of Human calcium/calmodulin-dependent protein kinase II inhibitor 2 (CAMK2N2), mGFP tagged |
CNY 5,890.00 |
|
RG211256 | CAMK2N2 (tGFP-tagged) - Human calcium/calmodulin-dependent protein kinase II inhibitor 2 (CAMK2N2) |
CNY 4,370.00 |
其它CAMK2N2产品