TSLP (NM_033035) Human Untagged Clone
CAT#: SC305538
TSLP (untagged)-Human thymic stromal lymphopoietin (TSLP), transcript variant 1
CNY 1,200.00
CNY 3,990.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_033035 edited
TCCACGTATGTTCCCTTTTGCCTTACTATATGTTCTGTCAGTTTCTTTCAGGAAAATCTT CATCTTACAACTTGTAGGGCTGGTGTTAACTTACGACTTCACTAACTGTGACTTTGAGAA GATTAAAGCAGCCTATCTCAGTACTATTTCTAAAGACCTGATTACATATATGAGTGGGAC CAAAAGTACCGAGTTCAACAACACCGTCTCTTGTAGCAATCGGCCACATTGCCTTACTGA AATCCAGAGCCTAACCTTCAATCCCACCGCCGGCTGCGCGTCGCTCGCCAAAGAAATGTT CGCCATGAAAACTAAGGCTGCCTTAGCTATCTGGTGCCCAGGCTATTCGGAAACTCAGAT AAATGCTACTCAGGCAATGAAGAAGAGGAGAAAAAGGAAAGTCACAACCAATAAATGTCT GGAACAAGTGTCACAATTACAAGGATTGTGGCGTCGCTTCAATCGACCTTTACTGAAACA ACAGTAAACCATCTTTATTATGGTCATATTTCACAGCACCAAAATAAATCATCTTTATTA AGTAGATGAAACATTAACTCTAACTGTGACAAAGAAGACCACAAATAGTTATCTTTTAAT TACAGAAGAGTTTCTTAACTTACTTTTGTAAGTTTTTATTGTGTAAGTTTATAATGCAGG GGAAGTACTACTCCTCAAATGTTGAGGGAAGCTTCCATAACATTGATGACTGGCTTCATG GCAGTAATTCTCGGCTGTAGTTGCATAAGCATTGCTCAAGAGGAAAATCCAAAAGTGCAG CAGGAGAACTCTTTTCCCTGAAAAAGGAAAAATATTGAACTCAATGATAGCACCTAAACT TACATTTAAAAGACAGACATTCCTTCTACATGTAATGACACTTCTTGTGTTAAACTAAAA ATTTACAAGAGAAGAAAGTGAAAGCAAATGGGGTTTCACAAATAGTTGTAAATATAGTGA AGCAATTTGAAATAATTTTCAAGCAAAGTATTGTGAAAGTATTCTAAGCCAAGTTTTAAA TATTATCTAACAGACAAGAGTGGTATATACAAGTAGATCCTGAGAAGTACCTTTGTTACA GCTACTATAAATATACATATAAATTATAGAATCTACTTTAATTTATTTTGTGAACACTTT TGAAAATGTACATGTTCCTTTGTAATTGACACTATATATTTCTTAATAAAATAATTCTCA AATTTGCAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_033035 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | ORF matches to NM_033035.3. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_033035.3, NP_149024.1 |
RefSeq Size | 2652 bp |
RefSeq ORF | 480 bp |
Locus ID | 85480 |
UniProt ID | Q969D9 |
Protein Families | Druggable Genome |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
Gene Summary | This gene encodes a hemopoietic cytokine proposed to signal through a heterodimeric receptor complex composed of the thymic stromal lymphopoietin receptor and the IL-7R alpha chain. It mainly impacts myeloid cells and induces the release of T cell-attracting chemokines from monocytes and enhances the maturation of CD11c(+) dendritic cells. The protein promotes T helper type 2 (TH2) cell responses that are associated with immunity in various inflammatory diseases, including asthma, allergic inflammation and chronic obstructive pulmonary disease. The protein is therefore considered a potential therapeutic target for the treatment of such diseases. In addition, the shorter (predominant) isoform is an antimicrobial protein, displaying antibacterial and antifungal activity against B. cereus, E. coli, E. faecalis, S. mitis, S. epidermidis, and C. albicans. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2020] Transcript Variant: This variant (1) encodes the longer isoform (1, also known as lfTSLP). This isoform is found in much lower abundance compared to the shorter isoform sfTSLP (PMID:24850429) and is known to stimulate allergic inflammation in diseases such as asthma and COPD. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Soluble IL7Ra potentiates IL-7 bioactivity and promotes autoimmunity
,Wangko Lundström, Steven Highfill, Scott T. R. Walsh, Stephanie Beq, Elizabeth Morse, Ingrid Kockum, Lars Alfredsson, Tomas Olsson, Jan Hillert, and Crystal L. Mackall,
PNAS, May 2013; 110: E1761 - E1770.
,PubMed ID 23610432
[TSLP]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214101 | TSLP (Myc-DDK-tagged)-Human thymic stromal lymphopoietin (TSLP), transcript variant 1 |
CNY 1,200.00 |
|
RC214101L1 | Lenti ORF clone of Human thymic stromal lymphopoietin (TSLP), transcript variant 1, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC214101L2 | Lenti ORF clone of Human thymic stromal lymphopoietin (TSLP), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC214101L3 | Lenti ORF clone of Human thymic stromal lymphopoietin (TSLP), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214101L4 | Lenti ORF clone of Human thymic stromal lymphopoietin (TSLP), transcript variant 1, mGFP tagged |
CNY 3,600.00 |
|
RG214101 | TSLP (tGFP-tagged) - Human thymic stromal lymphopoietin (TSLP), transcript variant 1 |
CNY 2,800.00 |