PDGF beta (PDGFB) (NM_033016) Human Untagged Clone

CAT#: SC305533

PDGFB (untagged)-Human platelet-derived growth factor beta polypeptide (PDGFB), transcript variant 2



  "NM_033016" in other vectors (4)

CN¥ 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-PDGFB Rabbit Polyclonal Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms c-sis; IBGC5; PDGF-2; PDGF2; SIS; SSV
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305533 representing NM_033016.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTTATCATGGGCCTCGGGGACCCCATTCCCGAGGAGCTTTATGAGATGCTGAGTGACCACTCGATC
CGCTCCTTTGATGATCTCCAACGCCTGCTGCACGGAGACCCCGGAGAGGAAGATGGGGCCGAGTTGGAC
CTGAACATGACCCGCTCCCACTCTGGAGGCGAGCTGGAGAGCTTGGCTCGTGGAAGAAGGAGCCTGGGT
TCCCTGACCATTGCTGAGCCGGCCATGATCGCCGAGTGCAAGACGCGCACCGAGGTGTTCGAGATCTCC
CGGCGCCTCATAGACCGCACCAACGCCAACTTCCTGGTGTGGCCGCCCTGTGTGGAGGTGCAGCGCTGC
TCCGGCTGCTGCAACAACCGCAACGTGCAGTGCCGCCCCACCCAGGTGCAGCTGCGACCTGTCCAGGTG
AGAAAGATCGAGATTGTGCGGAAGAAGCCAATCTTTAAGAAGGCCACGGTGACGCTGGAAGACCACCTG
GCATGCAAGTGTGAGACAGTGGCAGCTGCACGGCCTGTGACCCGAAGCCCGGGGGGTTCCCAGGAGCAG
CGAGCCAAAACGCCCCAAACTCGGGTGACCATTCGGACGGTGCGAGTCCGCCGGCCCCCCAAGGGCAAG
CACCGGAAATTCAAGCACACGCATGACAAGACGGCACTGAAGGAGACCCTTGGAGCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_033016
Insert Size 681 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_033016.3
RefSeq Size 2701 bp
RefSeq ORF 681 bp
Locus ID 5155
UniProt ID P01127
Protein Families Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, Focal adhesion, Gap junction, Glioma, MAPK signaling pathway, Melanoma, Pathways in cancer, Prostate cancer, Regulation of actin cytoskeleton, Renal cell carcinoma
MW 25.5 kDa
Gene Summary This gene encodes a member of the protein family comprised of both platelet-derived growth factors (PDGF) and vascular endothelial growth factors (VEGF). The encoded preproprotein is proteolytically processed to generate platelet-derived growth factor subunit B, which can homodimerize, or alternatively, heterodimerize with the related platelet-derived growth factor subunit A. These proteins bind and activate PDGF receptor tyrosine kinases, which play a role in a wide range of developmental processes. Mutations in this gene are associated with meningioma. Reciprocal translocations between chromosomes 22 and 17, at sites where this gene and that for collagen type 1, alpha 1 are located, are associated with dermatofibrosarcoma protuberans, a rare skin tumor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon, resulting in the use of an alternate start codon compared to variant (1). The encoded isoform (2) has a shorter and distinct N-terminus, and lacks a signal peptide compared to isoform 1. It is not known whether this isoform (2) is proteolytically processed in the same manner as isoform (1). CCDS Note: This CCDS representation is based on X83705.1. Although this mRNA accession lacks the final two exons, data in PMID:7659502 support the full-length nature of the transcript, and also the presence of a functional promoter at the 5' end.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...