HES7 (NM_032580) Human Untagged Clone
CAT#: SC305482
HES7 (untagged)-Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHb37; SCDO4 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_032580, the custom clone sequence may differ by one or more nucleotides
ATGGTCACCCGGGATCGAGCTGAGAATAGGGACGGCCCCAAGATGCTCAAGCCGCTTGTGGAGAAGCGGC GCCGGGACCGCATCAACCGCAGCCTGGAAGAGCTGAGGCTGCTGCTGCTGGAGCGGACCCGGGACCAGAA CCTCCGGAACCCGAAGCTGGAGAAAGCGGAGATATTGGAGTTCGCCGTGGGCTACTTGAGGGAGCGAAGC CGGGTGGAGCCCCCGGGGGTTCCCCGGTCCCCAGTCCAGGACGCCGAGGCGCTCGCCAGCTGCTACTTGT CCGGTTTCCGCGAGTGCCTGCTTCGCTTGGCGGCCTTCGCGCACGACGCCAGCCCGGCCGCCCGCGCCCA GCTCTTCTCCGCGCTGCACGGCTATCTGCGCCCCAAACCGCCCCGGCCCAAGCCGGTAGATCCGAGGCCT CCAGCGCCGCGCCCATCCCTGGACCCCGCCGCACCGGCCCTTGGCCCTGCGCTGCACCAGCGCCCCCCAG TGCACCAGGGCCACCCTAGCCCGCGCTGCGCATGGTCCCCATCCCTCTGCTCCCCGCGCGCCGGGGATTC TGGCGCGCCGGCGCCCCTCACCGGACTGCTGCCGCCGCCACCGCCGCCTCACAGACAAGACGGGGCGCCC AAGGCCCCGCTGCCCCCGCCGCCCGCTTTCTGGAGACCTTGGCCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_032580 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_032580.1, NP_115969.1 |
RefSeq Size | 678 bp |
RefSeq ORF | 678 bp |
Locus ID | 84667 |
UniProt ID | F8VPC9 |
Gene Summary | This gene encodes a member of the hairy and enhancer of split family of bHLH transcription factors. The mouse ortholog of this gene is regulated by Notch signaling. The protein functions as a transcriptional repressor, and is implicated in correct patterning of the axial skeleton. A mutation in this gene has been shown to result in spondylocostal dysostosis. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) uses an alternate in-frame splice site, compared to variant 1. The resulting isoform (2) lacks a five amino acid segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219701 | HES7 (Myc-DDK-tagged)-Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 2 |
CNY 2,400.00 |
|
RC219701L1 | Lenti ORF clone of Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC219701L2 | Lenti ORF clone of Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC219701L3 | Lenti ORF clone of Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC219701L4 | Lenti ORF clone of Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG219701 | HES7 (tGFP-tagged) - Human hairy and enhancer of split 7 (Drosophila) (HES7), transcript variant 2 |
CNY 4,000.00 |