HOXA6 (NM_024014) Human Untagged Clone

CAT#: SC305089

HOXA6 (untagged)-Human homeobox A6 (HOXA6)



  "NM_024014" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-HOXA6 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HOX1; HOX1.2; HOX1B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305089 representing NM_024014.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTTCCTATTTTGTGAATCCCACTTTCCCCGGGAGCCTTCCCAGCGGCCAGGACTCCTTCTTGGGC
CAGCTGCCCCTCTACCAGGCTGGCTATGACGCGCTGAGGCCCTTCCCGGCCTCGTACGGGGCGTCGAGT
CTCCCGGACAAGACGTACACCTCACCTTGTTTCTACCAACAGTCCAACTCGGTCCTGGCCTGCAACCGG
GCGTCCTACGAGTACGGGGCCTCGTGTTTCTATTCTGATAAGGACCTCAGTGGCGCCTCGCCCTCGGGC
AGTGGCAAGCAGAGGGGCCCCGGGGACTACCTGCACTTTTCTCCCGAGCAGCAGTACAAACCCGACAGC
AGCAGCGGGCAGGGCAAAGCACTCCATGACGAAGGCGCCGACCGGAAGTACACGAGCCCGGTTTACCCT
TGGATGCAGCGGATGAACTCCTGCGCGGGTGCTGTGTATGGGAGCCATGGGCGCCGAGGCCGCCAGACC
TACACGCGCTACCAGACACTGGAGCTGGAGAAGGAGTTCCACTTCAACCGCTACCTGACACGGCGCCGC
CGCATCGAGATCGCCAACGCGCTCTGCCTCACCGAGCGCCAGATCAAGATCTGGTTCCAGAACCGCCGC
ATGAAGTGGAAAAAGGAAAACAAGCTCATCAATTCCACGCAGCCCAGCGGGGAGGACTCAGAGGCAAAG
GCGGGCGAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_024014
Insert Size 702 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_024014.3
RefSeq Size 802 bp
RefSeq ORF 702 bp
Locus ID 3203
UniProt ID P31267
Protein Families Transcription Factors
MW 26.3 kDa
Gene Summary In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...