United States
Germany
Japan
United Kingdom
China
PRRX1 (NM_022716) Human Untagged Clone
CAT＃: SC305044
PRRX1 (untagged)-Human paired related homeobox 1 (PRRX1), transcript variant pmx-1b
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AGOTC; PHOX1; PMX1; PRX-1; PRX1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC305044 representing NM_022716.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACCTCCAGCTACGGGCACGTTCTGGAGCGGCAACCGGCGCTGGGCGGCCGCTTGGACAGCCCGGGC AACCTCGACACCCTGCAGGCGAAAAAGAACTTCTCCGTCAGTCACCTGCTAGACCTGGAGGAAGCCGGG GACATGGTGGCGGCACAGGCGGATGAGAACGTGGGCGAGGCTGGCCGGAGCCTGCTGGAGTCGCCGGGA CTCACCAGCGGCAGCGACACCCCGCAGCAGGACAATGACCAGCTGAACTCAGAAGAAAAAAAGAAGAGA AAGCAGCGAAGGAATAGGACAACCTTCAATAGCAGCCAGCTGCAGGCTTTGGAGCGTGTCTTTGAGCGG ACACACTATCCTGATGCTTTTGTGCGAGAAGACCTTGCCCGCCGGGTGAACCTCACCGAGGCGAGAGTG CAGGTGTGGTTTCAGAACCGAAGAGCCAAGTTCCGCAGGAATGAGAGAGCCATGCTAGCCAATAAAAAC GCTTCCCTCCTCAAATCCTACTCAGGAGACGTGACTGCTGTGGAGCAGCCCATCGTACCTCGTCCTGCT CCGAGACCCACCGATTATCTCTCCTGGGGGACAGCGTCTCCGTACAGCGCCATGGCTACTTATTCTGCC ACATGTGCCAACAATAGCCCTGCACAGGGCATCAACATGGCCAACAGCATTGCCAACCTGAGACTGAAG GCCAAGGAATATAGTTTACAGAGGAACCAGGTGCCAACAGTCAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_022716 |
| Insert Size | 738 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_022716.3 |
| RefSeq Size | 3999 bp |
| RefSeq ORF | 738 bp |
| Locus ID | 5396 |
| UniProt ID | P54821 |
| Protein Families | Transcription Factors |
| MW | 27.3 kDa |
| Gene Summary | The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription co-activator, enhancing the DNA-binding activity of serum response factor, a protein required for the induction of genes by growth and differentiation factors. The protein regulates muscle creatine kinase, indicating a role in the establishment of diverse mesodermal muscle types. Alternative splicing yields two isoforms that differ in abundance and expression patterns. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (pmx-1b) encodes the longer isoform (pmx-1b). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210393 | PRRX1 (Myc-DDK-tagged)-Human paired related homeobox 1 (PRRX1), transcript variant pmx-1b |
CNY 2,400.00 |
|
| RC210393L1 | Lenti ORF clone of Human paired related homeobox 1 (PRRX1), transcript variant pmx-1b, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC210393L2 | Lenti ORF clone of Human paired related homeobox 1 (PRRX1), transcript variant pmx-1b, mGFP tagged |
CNY 5,890.00 |
|
| RC210393L3 | Lenti ORF clone of Human paired related homeobox 1 (PRRX1), transcript variant pmx-1b, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC210393L4 | Lenti ORF clone of Human paired related homeobox 1 (PRRX1), transcript variant pmx-1b, mGFP tagged |
CNY 4,800.00 |
|
| RG210393 | PRRX1 (tGFP-tagged) - Human paired related homeobox 1 (PRRX1), transcript variant pmx-1b |
CNY 4,000.00 |
