United States
Germany
Japan
United Kingdom
China
Secretin (SCT) (NM_021920) Human Untagged Clone
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_021920 edited
ATGGCCCCCCGGCCCCTCCTCCTGCTGCTGCTGCTCCTCGGGGGCTCCGCCGCGCGCCCC GCGCCCCCCAGGGCCCGGCGACACTCAGACGGGACGTTCACCAGCGAGCTCAGCCGCCTG CGGGAGGGCGCGCGGCTCCAGCGGCTGCTACAGGGCCTGGTGGGGAAGCGCAGCGAGCAG GACGCAGAGAACAGCATGGCCTGGACCAGGCTCAGCGCGGGTCTGCTCTGCCCGTCAGGG TCCAACATGCCCATCCTGCAGGCCTGGATGCCCCTGGACGGGACCTGGTCTCCCTGGCTG CCCCCTGGGCCTATGGTTTCAGAACCAGCTGGCGCTGCTGCAGAAGGAACCTTGCGGCCC AGATGA |
| Restriction Sites | Please inquire |
| ACCN | NM_021920 |
| Insert Size | 500 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021920.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_021920.2, NP_068739.1 |
| RefSeq Size | 514 bp |
| RefSeq ORF | 366 bp |
| Locus ID | 6343 |
| UniProt ID | P09683 |
| Protein Families | Druggable Genome, Secreted Protein |
| Gene Summary | This gene encodes a member of the glucagon family of peptides. The encoded preproprotein is secreted by endocrine S cells in the proximal small intestinal mucosa as a prohormone, then proteolytically processed to generate the mature peptide hormone. The release of this active peptide hormone is stimulated by either fatty acids or acidic pH in the duodenum. This hormone stimulates the secretion of bile and bicarbonate in the duodenum, pancreatic and biliary ducts. [provided by RefSeq, Feb 2016] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218129 | SCT (Myc-DDK-tagged)-Human secretin (SCT) |
CNY 1,200.00 |
|
| RC218129L1 | Lenti ORF clone of Human secretin (SCT), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC218129L2 | Lenti ORF clone of Human secretin (SCT), mGFP tagged |
CNY 5,890.00 |
|
| RC218129L3 | Lenti ORF clone of Human secretin (SCT), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC218129L4 | Lenti ORF clone of Human secretin (SCT), mGFP tagged |
CNY 5,890.00 |
|
| RG218129 | SCT (tGFP-tagged) - Human secretin (SCT) |
CNY 2,800.00 |
其它Secretin产品
