Secretin (SCT) (NM_021920) Human Untagged Clone

CAT#: SC304969

SCT (untagged)-Human secretin (SCT)



  "NM_021920" in other vectors (6)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-SCT Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_021920 edited
ATGGCCCCCCGGCCCCTCCTCCTGCTGCTGCTGCTCCTCGGGGGCTCCGCCGCGCGCCCC
GCGCCCCCCAGGGCCCGGCGACACTCAGACGGGACGTTCACCAGCGAGCTCAGCCGCCTG
CGGGAGGGCGCGCGGCTCCAGCGGCTGCTACAGGGCCTGGTGGGGAAGCGCAGCGAGCAG
GACGCAGAGAACAGCATGGCCTGGACCAGGCTCAGCGCGGGTCTGCTCTGCCCGTCAGGG
TCCAACATGCCCATCCTGCAGGCCTGGATGCCCCTGGACGGGACCTGGTCTCCCTGGCTG
CCCCCTGGGCCTATGGTTTCAGAACCAGCTGGCGCTGCTGCAGAAGGAACCTTGCGGCCC
AGATGA
Restriction Sites Please inquire     
ACCN NM_021920
Insert Size 500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021920.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_021920.2, NP_068739.1
RefSeq Size 514 bp
RefSeq ORF 366 bp
Locus ID 6343
UniProt ID P09683
Protein Families Druggable Genome, Secreted Protein
Gene Summary This gene encodes a member of the glucagon family of peptides. The encoded preproprotein is secreted by endocrine S cells in the proximal small intestinal mucosa as a prohormone, then proteolytically processed to generate the mature peptide hormone. The release of this active peptide hormone is stimulated by either fatty acids or acidic pH in the duodenum. This hormone stimulates the secretion of bile and bicarbonate in the duodenum, pancreatic and biliary ducts. [provided by RefSeq, Feb 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...