CCNO (NM_021147) Human Untagged Clone

CAT#: SC304913

CCNO (untagged)-Human cyclin O (CCNO)



  "NM_021147" in other vectors (6)

CNY 5,700.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal UNG2 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CCNU; CILD29; UDG2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC304913 representing NM_021147.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGACCCCCTGTCCCACCAGCCCCTCGAGCCCCGCCGCCCGAGCGGGGAGGCGGGACAACGACCAG
AACCTTCGCGCCCCGGTGAAGAAGAGCAGGCGTCCGCGCCTCCGGAGGAAGCAGCCGCTGCATCCCCTG
AACCCGTGCCCGCTCCCGGGAGACTCCGGCATTTGCGACCTGTTCGAGTCCCCCAGCTCCGGCTCAGAC
GGCGCAGAGAGCCCCTCTGCGGCGCGGGGTGGTAGCCCCCTGCCCGGCCCGGCCCAGCCCGTGGCGCAG
CTAGATCTACAGACCTTCCGCGACTACGGCCAGAGCTGCTACGCCTTCCGCAAGGCGCAGGAGAGCCAC
TTCCACCCGCGGGAGGCGCTGGCACGGCAGCCACAAGTGACGGCGGAATCCCGCTGTAAGCTGCTCAGC
TGGCTGATCCCGGTGCACCGCCAATTCGGCCTCTCCTTCGAGTCGCTGTGCCTGACGGTGAACACTCTG
GACCGCTTCCTCACCACCACGCCGGTGGCTGCAGACTGCTTCCAGCTGCTTGGGGTCACCTCCTTGCTC
ATCGCTTGCAAACAGGTGGAGGTGCACCCGCCGCGCGTGAAGCAGCTTCTGGCCCTCTGCTGCGGCGCC
TTCTCCCGGCAGCAGCTCTGCAACCTCGAGTGCATCGTGCTGCACAAGCTGCACTTCACCCTGGGTGCG
CCCACCATTAGCTTCTTCCTGGAGCATTTCACGCACGCTCGCGTGGAGGCGGGGCAGGCTGAGGCCTCC
GAAGCTCTGGAAGCGCAAGCCCTGGCGCGGGGGGTGGCAGAGCTGAGTCTGGCCGACTATGCCTTCACC
AGCTACTCCCCTTCCCTCCTGGCGATCTGCTGCCTGGCGCTGGCGGACCGCATGCTGCGGGTCTCGCGG
CCCGTGGACTTGCGACTGGGAGACCACCCGGAGGCGGCGCTGGAGGACTGTATGGGCAAGTTGCAGCTG
CTGGTGGCCATAAACAGTACTTCCTTGACTCACATGCTGCCCGTTCAGATCTGCGAGAAGTGCAGCCTG
CCCCCGAGCTCGAAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_021147
Insert Size 1053 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_021147.4
RefSeq Size 1485 bp
RefSeq ORF 1053 bp
Locus ID 10309
UniProt ID P22674
MW 38.1 kDa
Gene Summary This gene encodes a member of the cyclin protein family, and the encoded protein is involved in regulation of the cell cycle. Disruption of this gene is associated with primary ciliary dyskinesia-19. Alternative splicing results in multiple transcript variants. This gene, which has a previous symbol of UNG2, was erroneously identified as a uracil DNA glycosylase in PubMed ID: 2001396. A later publication, PubMed ID: 8419333, identified this gene's product as a cyclin protein family member. The UNG2 symbol is also used as a specific protein isoform name for the UNG gene (GeneID 7374), so confusion exists in the scientific literature and in some databases for these two genes. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (1) encodes the functional protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...