TROY (TNFRSF19) (NM_018647) Human Untagged Clone
CAT#: SC304617
TNFRSF19 (untagged)-Human tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), transcript variant 1
CNY 3,656.00
CNY 6,840.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TAJ; TAJ-alpha; TRADE; TROY |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_018647 edited
TGCCAGGAGAAACTAAGTTGCTGAACGGAACTCTCCAACAATAAATACATTTGATAAGAA AGATGGCTTTAAAAGTGCTACTAGAACAAGAGAAAACGTTTTTCACTCTTTTAGTATTAC TAGGCTATTTGTCATGTAAAGTGACTTGTGAATCAGGAGACTGTAGACAGCAAGAATTCA GGGATCGGTCTGGAAACTGTGTTCCCTGCAACCAGTGTGGGCCAGGCATGGAGTTGTCTA AGGAATGTGGCTTCGGCTATGGGGAGGATGCACAGTGTGTGACGTGCCGGCTGCACAGGT TCAAGGAGGACTGGGGCTTCCAGAAATGCAAGCCCTGTCTGGACTGCGCAGTGGTGAACC GCTTTCAGAAGGCAAATTGTTCAGCCACCAGTGATGCCATCTGCGGGGACTGCTTGCCAG GATTTTATAGGAAGACGAAACTTGTCGGCTTTCAAGACATGGAGTGTGTGCCTTGTGGAG ACCCTCCTCCTCCTTACGAACCGCACTGTGCCAGCAAGGTCAACCTCGTGAAGATCGCGT CCACGGCCTCCAGCCCACGGGACACGGCGCTGGCTGCCGTTATCTGCAGCGCTCTGGCCA CCGTCCTGCTGGCCCTGCTCATCCTCTGTGTCATCTATTGTAAGAGACAGTTTATGGAGA AGAAACCCAGCTGGTCTCTGCGGTCACAGGACATTCAGTACAACGGCTCTGAGCTGTCGT GTTTTGACAGACCTCAGCTCCACGAATATGCCCACAGAGCCTGCTGCCAGTGCCGCCGTG ACTCAGTGCAGACCTGCGGGCCGGTGCGCTTGCTCCCATCCATGTGCTGTGAGGAGGCCT GCAGCCCCAACCCGGCGACTCTTGGTTGTGGGGTGCATTCTGCAGCCAGTCTTCAGGCAA GAAACGCAGGCCCAGCCGGGGAGATGGTGCCGACTTTCTTCGGATCCCTCACGCAGTCCA TCTGTGGCGAGTTTTCAGATGCCTGGCCTCTGATGCAGAATCCCATGGGTGGTGACAACA TCTCTTTTTGTGACTCTTATCCTGAACTCACTGGAGAAGACATTCATTCTCTCAATCCAG AACTTGAAAGCTCAACGTCTTTGGATTCAAATAGCAGTCAAGATTTGGTTGGTGGGGCTG TTCCAGTCCAGTCTCATTCTGAAAACTTTACAGCAGCTACTGATTTATCTAGATATAACA ACACACTGGTAGAATCAGCATCAACTCAGGATGCACTAACTATGAGAAGCCAGCTAGATC AGGAGAGTGGCGCTGTCATCCACCCAGCCACTCAGACGTCCCTCCAGGTAAGGCAGCGAC TGGGTTCCCTGTGAG |
Restriction Sites | Please inquire |
ACCN | NM_018647 |
Insert Size | 1300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_018647.2, NP_061117.2 |
RefSeq Size | 1485 bp |
RefSeq ORF | 1272 bp |
Locus ID | 55504 |
UniProt ID | Q9NS68 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction |
Gene Summary | The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is highly expressed during embryonic development. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. This receptor is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1, also known as TRADEbeta) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214944 | TNFRSF19 (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), transcript variant 1 |
CNY 3,656.00 |
|
RC214944L1 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC214944L2 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC214944L3 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214944L4 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG214944 | TNFRSF19 (tGFP-tagged) - Human tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), transcript variant 1 |
CNY 5,256.00 |