YOD1 (NM_018566) Human Untagged Clone

CAT#: SC304609

YOD1 (untagged)-Human YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) (YOD1)



  "NM_018566" in other vectors (6)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal YOD1 Antibody (C-term)
    • 400 ul

CNY 6,314.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DUBA8; OTUD2; PRO0907
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC304609 representing NM_018566.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTTGGCCCCGCTAAAGGTCGCCATTTTGGAGTCCACCCGGCGCCTGGTTTCCCCGGCGGCGTCTCC
CAACAGGCTGCCGGGACCAAAGCTGGCCCCGCGGGTGCCTGGCCTGTGGGCAGCCGGACCGACACGATG
TGGCGGCTCCGCTGCAAGGCCAAGGACGGCACCCATGTTTTGCAGGGGCTGTCCAGCCGGACCCGGGTG
CGGGAACTCCAGGGCCAAATTGCCGCCATCACCGGGATCGCCCCCGGCGGTCAGCGAATCCTCGTCGGA
TACCCTCCCGAGTGCCTGGATCTCAGCAATGGGGATACCATTCTGGAAGACTTGCCCATCCAATCTGGT
GACATGCTGATCATTGAAGAAGACCAAACCAGGCCCAGAAGTTCACCTGCATTTACTAAACGTGGTGCT
TCTAGTTACGTCAGGGAAACTTTGCCTGTGCTTACCAGAACCGTGGTCCCAGCAGACAACTCTTGCCTC
TTTACTAGTGTGTACTATGTCGTCGAAGGAGGAGTCTTGAATCCAGCTTGTGCCCCTGAGATGAGACGC
CTCATAGCACAAATTGTAGCAAGCGATCCAGACTTCTATAGTGAGGCAATACTGGGAAAAACAAATCAA
GAGTACTGTGACTGGATCAAAAGGGATGACACTTGGGGAGGAGCAATAGAGATATCGATTTTGTCCAAG
TTTTACCAATGTGAAATATGTGTAGTGGATACACAGACAGTAAGAATTGATCGTTTTGGGGAAGATGCA
GGATATACCAAAAGGGTTCTGCTTATTTATGATGGCATCCACTATGATCCACTTCAGCGTAACTTCCCT
GATCCAGATACACCTCCTCTGACCATTTTCTCCTCTAATGATGATATTGTTCTTGTACAAGCACTGGAA
TTAGCAGATGAAGCTAGAAGAAGGAGACAGTTTACTGATGTCAACCGCTTCACCCTGAGATGCATGGTA
TGTCAGAAAGGATTAACTGGACAAGCAGAAGCAAGGGAACATGCCAAGGAGACAGGCCATACCAACTTT
GGAGAAGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_018566
Insert Size 1047 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_018566.3
RefSeq Size 6265 bp
RefSeq ORF 1047 bp
Locus ID 55432
UniProt ID Q5VVQ6
Protein Pathways Biosynthesis of unsaturated fatty acids, Limonene and pinene degradation
MW 38.3 kDa
Gene Summary Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. The protein encoded by this gene belongs to a DUB subfamily characterized by an ovarian tumor (OTU) domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...