PPPDE2 (DESI1) (NM_015704) Human Untagged Clone

CAT#: SC304346

DESI1 (untagged)-Human PPPDE peptidase domain containing 2 (PPPDE2)



  "NM_015704" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-D15Wsu75e Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms D15Wsu75e; DeSI-1; DESI2; DJ347H13.4; FAM152B; POST; PPPDE2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC304346 representing NM_015704.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGCCGCCGAATCTCTATCCGGTGAAGCTCTACGTGTACGACCTGTCCAAAGGCCTGGCCCGGCGG
CTCAGCCCCATCATGCTGGGGAAACAACTGGAAGGCATCTGGCACACATCCATAGTTGTGCACAAGGAT
GAGTTCTTCTTCGGCAGTGGTGGTATCTCCAGCTGCCCCCCGGGAGGGACATTGCTTGGGCCTCCAGAC
TCTGTGGTTGATGTGGGGAGTACAGAAGTCACAGAAGAAATCTTTCTGGAGTACCTCTCCTCCCTGGGG
GAGTCCCTGTTCCGAGGTGAGGCCTACAACCTCTTTGAACACAATTGTAACACCTTCAGCAACGAAGTG
GCACAGTTCCTGACTGGGCGGAAGATTCCTTCTTACATCACAGACCTGCCCTCTGAAGTTCTCTCCACG
CCCTTTGGACAGGCACTTCGGCCCCTCCTGGACTCCATTCAGATCCAGCCTCCAGGAGGGAGCTCCGTG
GGCAGACCCAACGGCCAGAGCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_015704
Insert Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_015704.2
RefSeq Size 3804 bp
RefSeq ORF 507 bp
Locus ID 27351
UniProt ID Q6ICB0
MW 18.3 kDa
Gene Summary Protease which deconjugates SUMO1, SUMO2 and SUMO3 from some substrate proteins. Has isopeptidase but not SUMO-processing activity (By similarity). Desumoylates ZBTB46 (By similarity). Collaborates with UBQLN4 in the export of ubiquitinated proteins from the nucleus to the cytoplasm (PubMed:29666234).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...